View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12553_low_5 (Length: 306)
Name: NF12553_low_5
Description: NF12553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12553_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 23 - 293
Target Start/End: Complemental strand, 16921949 - 16921672
Alignment:
| Q |
23 |
accacttatcaaattatcaaagttgaannnnnnnaatgagagctaaaaccacaaaaacaaacatggcaaagatcacaagcttcaaattcgatatatagtt |
122 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
16921949 |
accacttatcaaattatcaaagttggatttttt-aatgagagctaaaaccacaaaaacaaacatggtaaagatcacaagcttcaaattcgacatatagtt |
16921851 |
T |
 |
| Q |
123 |
ttcaaactttttcaactcctttatgcattgtagaaattat--------tttctgccttggtcctttcttcactctcttcaataaatttgtcaacaattgt |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16921850 |
ttcaaactttttcagctcctttatgcattgtagaaattataaactcattttctgccctggtcctttcttcactctcttcaataaatttgtcaacaattgt |
16921751 |
T |
 |
| Q |
215 |
tttgaagcatgatatctggtcttgtagttctttaaactcagttgccaattctttctagacttctacacgaacttcttct |
293 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
16921750 |
tttgaagcatgatatctggtcttgtagctctttaaactcagttgccaattctttctggacttctacacgagcttcttct |
16921672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University