View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12557_high_10 (Length: 248)
Name: NF12557_high_10
Description: NF12557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12557_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 136 - 241
Target Start/End: Original strand, 4809630 - 4809735
Alignment:
| Q |
136 |
gtagttcttgtttttgtcttaactttaagagtgggtcttatagtgtaggctttgaagttcggagtaccatactctcaagctataatgtttatatattttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
4809630 |
gtagttcttgtttttgtcttaactttaagagtgggtcttatagtgtaggctttgaggttcggagtaccctagtctcaagctttaatgtttatatattttt |
4809729 |
T |
|
| Q |
236 |
gatgtc |
241 |
Q |
| |
|
| |||| |
|
|
| T |
4809730 |
ggtgtc |
4809735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University