View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12557_low_10 (Length: 249)
Name: NF12557_low_10
Description: NF12557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12557_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 4809472 - 4809217
Alignment:
| Q |
1 |
ccccgaaggatgtccctgttagaaagtttggttaggtttgtggggt--------------aggcatgtgacatcagccctgacgtaatctaatcaataat |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4809472 |
ccccgaaggatgtcccttttagaaagtttggttaggtttgtggggtgtaagttaatccttaggcatatgacatcagccctgacgtaatctaatcaataat |
4809373 |
T |
|
| Q |
87 |
tgcacaaccccccacccactcattgatcctcctaacaatccagtataaaacatgagtagtactccctatgttttgtacaccaagactgaaaatcagtaac |
186 |
Q |
| |
|
||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4809372 |
tgcac---ccccccttcactcattgatccccctaacaatccagtataaaacatgagtagtactccctatgttttgtacaccaagactgaaaatcagtaac |
4809276 |
T |
|
| Q |
187 |
taagaatggcttctttttccctatcatttctagtgttgttccttgcatctctgcttctc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4809275 |
taagaatggcttctttttccctatcatttctagtgttgttccttgcatctctgattctc |
4809217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University