View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12557_low_7 (Length: 324)
Name: NF12557_low_7
Description: NF12557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12557_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 305
Target Start/End: Complemental strand, 47535346 - 47535058
Alignment:
| Q |
17 |
ataaagaatgaagggttagaaaagttaccccagaaaacatatgagtactaacagggcaaccacgatcaaccaagcaataatcaaactgacccaaagcagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47535346 |
ataaagaatgaagggttagaaaagttaccccagaaaacatatgagtactaacagggcaaccacgatcaaccaagcaataatcaaactgacccaaagcagc |
47535247 |
T |
 |
| Q |
117 |
attaacacagtgttcagcggtccaaccggttccatcagagacaatatatatggacttagccctaaactctgacccgtcttcactgacagtgtcatccggg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47535246 |
attaacacagtgttcagcggtccaaccggttccatcagagacaatatatatggacttagccctaaactctgacccgtcttcactgacagtgtcatccggg |
47535147 |
T |
 |
| Q |
217 |
tcgaccgcgaagaggactgtaggttgagagttgttgggttctatggtttgagttcgtggactagaccggtccaattttcgaccggaacg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47535146 |
tcgaccgcgaagaggactgtaggttgagagttgttgggttctatggtttgagttcgtggactagaccggtccaattttcgaccggaacg |
47535058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University