View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12557_low_9 (Length: 283)
Name: NF12557_low_9
Description: NF12557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12557_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 16 - 272
Target Start/End: Original strand, 50055793 - 50056046
Alignment:
| Q |
16 |
cctgtaaagaagttgcgcctcattttcctcaatggaatttgaattaacttcatcgaaacctaattccggcacaagatgaaacggaatattattattatta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50055793 |
cctgtaaagaagttgcgcctcattttcctcaatggaatttgaattaacttcatcgaaacctaattccggcacaagatgaaacggaatatt---attatta |
50055889 |
T |
|
| Q |
116 |
ttccttgctggttcgctgctcgaggatgattttgatttgtgtttcccctgtctcggtgttcttgccttcttggtgaagccagagaaaggaccacaattga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50055890 |
ttccttgctggttcgctgctcgaggatgattttgatttgtgtttcccctgtctcggtgttcttgccttcttggtgaagccagagaaaggaccacaattga |
50055989 |
T |
|
| Q |
216 |
agaattcatcaccattaatggacttgtacgaagctgttttcaaacgaactctttcat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50055990 |
agaattcatcaccattaatggacttgtacgaagctgttttcaaacgaactctttcat |
50056046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University