View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12558_high_15 (Length: 267)
Name: NF12558_high_15
Description: NF12558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12558_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 36695621 - 36695413
Alignment:
| Q |
1 |
tgcttgaagtttacaacaatatgagcaatgtaaggaagccagcaaatggttatggtgatgattctgacacattaaggggatttgaatatgcagccatagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695621 |
tgcttgaagtttacaacaatatgagcaatgacaggaagccaccaaatggttatggtgatgattctgacacattaaggggatttgaatatgcagccatagg |
36695522 |
T |
|
| Q |
101 |
ttttgtaatgtcgtaaaaaagtaagtatcattgtgagaaaatgttgtataatatgtataatacgtctcccccacgccacatatattaaaaaagtgaacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695521 |
ttttgtaatgtcgtaaaaaagtaagtatcattgtgagaaaaagttgtataatatgtataatacgtctcccccacgccacatatattaaaaaagtgaacat |
36695422 |
T |
|
| Q |
201 |
gaactccat |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
36695421 |
gaactccat |
36695413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 151 - 246
Target Start/End: Complemental strand, 36675852 - 36675762
Alignment:
| Q |
151 |
atatgtataatacgtctcccccacgccacatatattaaaaaagtgaacatgaactccattttcctctccatcctctacatctccctcatacttgta |
246 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675852 |
atatgtataatatgtctcccccac-----atatattaaaaaattgaacatgaactccattttcctctccatcctctacatctccctcatacttgta |
36675762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 36676092 - 36676002
Alignment:
| Q |
1 |
tgcttgaagtttacaacaatatgagcaatgtaaggaagccagcaaatggttatggtgatgattctgacacattaaggggatttgaatatgc |
91 |
Q |
| |
|
||||||||||||||||||||||||| || || |||||| | ||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36676092 |
tgcttgaagtttacaacaatatgaggaacgttaggaagggaccaaatggttctggtgatgattctgacacattaaggggattagaatatgc |
36676002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 36673337 - 36673247
Alignment:
| Q |
1 |
tgcttgaagtttacaacaatatgagcaatgtaaggaagccagcaaatggttatggtgatgattctgacacattaaggggatttgaatatgc |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||| | | || | || ||||||||| |||||||||||| |||||||| |
|
|
| T |
36673337 |
tgcttgaagtttacaacaatatgagcaatgtaaggaagggacaaaatagctctgttaataattctgacagattaaggggattagaatatgc |
36673247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 36695410 - 36695382
Alignment:
| Q |
224 |
tctacatctccctcatacttgtaatttct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36695410 |
tctacatctccctcatacttgtaatttct |
36695382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University