View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12558_high_20 (Length: 247)
Name: NF12558_high_20
Description: NF12558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12558_high_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 247
Target Start/End: Original strand, 41623460 - 41623692
Alignment:
| Q |
15 |
acctaccacattaggaggttatgatataccaattgatgcaaatgttgaggtatatacagctggcataggtgaggaccctaaattatggtccaaccctgaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41623460 |
acctaccacattaggaggttatgatataccaattgatgcaaatgttgaggtatatacagctggcataggtgaggaccctaaattatggtccaaccctgaa |
41623559 |
T |
 |
| Q |
115 |
aagtttgatcctgaaaggtttctttctaaggatgaggaagctgatataactggtgttacaggagtaaaaatgatgccatttggtgttgggagaaggattt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41623560 |
aagtttgatcctgaaaggtttctttctaagggtgaggaagctgatataactggtgttacaggagtaaaaatgatgccatttggtgttgggagaaggattt |
41623659 |
T |
 |
| Q |
215 |
gtcctggtttggctattggtactgtgcatattc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41623660 |
gtcctggtttggctattggtactgtgcatattc |
41623692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University