View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12558_high_25 (Length: 217)
Name: NF12558_high_25
Description: NF12558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12558_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 50636109 - 50636283
Alignment:
| Q |
19 |
agacctgttacatctgcatcagaacttcttggatcagatttgagatagtgaatgcaatttgcataatttggagtttgtttgcaagtttgctgtatcaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50636109 |
agacctgttacatctgcatcagaacttcttggatcagatttgagatagtgaatgcaatttgcataatttggagtttgtttgcaagtttgctgtatcaaat |
50636208 |
T |
 |
| Q |
119 |
tagcattggattttggatggataattatgcagtgacttgaaaccatagtgcacaagatgatagctaatgctaatg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50636209 |
tagcattggattttggatggataattatgcagtgacttgaaaccatagtgcacaagatgatagctaatgctaatg |
50636283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 30 - 194
Target Start/End: Original strand, 50641218 - 50641385
Alignment:
| Q |
30 |
atctgcatcagaacttcttggatcagatttgagatagtgaatgcaatttgcataatttggagtttgtttgcaagtttgctgtatcaaattagcattg--- |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || | ||||||| |||||||||||||||||| ||||||||||| ||||||||| | |||||| |
|
|
| T |
50641218 |
atctgcatcagaggttcttggatcagatttgaggtacttaatgcaaagtgcataatttggagtttgcttgcaagtttgttgtatcaaagttgcattgttt |
50641317 |
T |
 |
| Q |
127 |
gattttggatggataattatgcagtgacttgaaaccatagtgcacaagatgatagctaatgctaatgc |
194 |
Q |
| |
|
| |||| ||| |||| || ||||||||| |||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
50641318 |
gttttttgattgatatttgtgcagtgacatgaaacaataatgcacaagaagatagctaatgctaatgc |
50641385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University