View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12558_low_21 (Length: 257)
Name: NF12558_low_21
Description: NF12558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12558_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 79 - 161
Target Start/End: Complemental strand, 1617758 - 1617676
Alignment:
| Q |
79 |
tctttacttctttctcagacaaaggctattcaatcctctcatctgaaatccatatttatcttgatgaattttgtcaaactcac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| || | | ||||||||||||||||||||||| |
|
|
| T |
1617758 |
tctttacttctttctcagacaaaggctattcaatcccctcatctgaaatccaaatctctgttgatgaattttgtcaaactcac |
1617676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 193 - 252
Target Start/End: Complemental strand, 1617679 - 1617620
Alignment:
| Q |
193 |
tcaccgctactcacaccactaaccctcccaaaactcttcctttcttatcttcttctctct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
1617679 |
tcaccgctactcacaccactaaccctcccaaaagtcttcctttcttatctttttctctct |
1617620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University