View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12558_low_22 (Length: 255)
Name: NF12558_low_22
Description: NF12558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12558_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 24684077 - 24683835
Alignment:
| Q |
1 |
ctattataaacctcaaacttaaagaacccctgttctaatttaaccttaatttattcaagaggttggtctcgccaagtggtgttctgctctctcttttatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
24684077 |
ctattataaacctcaaacttaaagaacccatgttctaatttaaccttaatttaatcaagaggttggtcttggcaagtggtgttctactctctcttttatc |
24683978 |
T |
 |
| Q |
101 |
caaannnnnnnnnnnnnnnnnnnnnnnaaataaaggatgacacatgacacagtacaatgtcatccaagtgctatccgatcatgtcttttactgtcctttt |
200 |
Q |
| |
|
|| | ||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
24683977 |
cagattttttgttttttaatattttttaaataaatagtgacacatgacacagtacaatgtcatccaagtgctatctgatcatatcttttactgtcctttt |
24683878 |
T |
 |
| Q |
201 |
agtctcgtctcttacaagtgattatactttacccgtgatgtcc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24683877 |
agtctcgtctcttacaagtgattatactttacccgtgatgtcc |
24683835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 46
Target Start/End: Original strand, 25848672 - 25848716
Alignment:
| Q |
2 |
tattataaacctcaaacttaaagaacccctgttctaatttaacct |
46 |
Q |
| |
|
||||||||||||||||||||||| |||| || | ||||||||||| |
|
|
| T |
25848672 |
tattataaacctcaaacttaaaggacccatggtgtaatttaacct |
25848716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University