View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12558_low_26 (Length: 238)
Name: NF12558_low_26
Description: NF12558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12558_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 101 - 221
Target Start/End: Complemental strand, 40684390 - 40684270
Alignment:
| Q |
101 |
acacatcactttagaaaggagactaaatagtagtaacaatctaacatctaagccgttggcaatgattttgcttaaaatcgtatggtcaattttgctaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40684390 |
acacatcactttagaaaggagactaaatagtagtaacaatctaacatctcagccgttggcaatgattttgcttaaaatcgtatggtcaattttgctagta |
40684291 |
T |
 |
| Q |
201 |
catgtgtgaggggtttagttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40684290 |
catgtgtgaggggtttagttg |
40684270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 40684431 - 40684391
Alignment:
| Q |
22 |
attacaaagtgttgtcaaatagtggctacagcaacaccata |
62 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40684431 |
attacaaagtgttgtcaaatagtggctatagcaacaccata |
40684391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University