View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12558_low_7 (Length: 422)
Name: NF12558_low_7
Description: NF12558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12558_low_7 |
 |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (5 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (3 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 174)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 43625971 - 43625681
Alignment:
| Q |
1 |
aacataaaacaaagaacttggggaacctaccccgttaaataagccaacatggcttgaatacttggtattttgcactttaacttaatcatttttatctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43625971 |
aacataaaacaaagaacttggggaacctaccccgttaaataagccaacgtggcttgagtacttggtattttgcactttaacttaatcatttttatctttt |
43625872 |
T |
 |
| Q |
101 |
taaagtatcttcgcatgtaattagagagagcttatctaataaagaaaacagagactaatccattcctagggtcttaaaatgtattttgacctaaataagt |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43625871 |
taaagtatcttcgcatgcaattagagagagcttatctaataaagaaaacagagactaatccattcctagggtcttaaaatgtattttgaccaaaataagt |
43625772 |
T |
 |
| Q |
201 |
cgttatggacaaatataactagacttttgctcaatctaattgttagtaatgttgcatttgcgatacaaatattatgtacagaatatatata |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43625771 |
cgttatggacaaatataactagacttttgctcaatctaattgtgagtaatgttgcatttgcgatacaaatattatgtacagaatatatata |
43625681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 302 - 389
Target Start/End: Original strand, 19494120 - 19494207
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19494120 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaa |
19494207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 302 - 389
Target Start/End: Original strand, 38930303 - 38930390
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38930303 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggtaaaaaaaaatttgtttttggtccctgcaaaa |
38930390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 16789076 - 16789130
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16789076 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 25131112 - 25131166
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25131112 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
25131166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 303 - 351
Target Start/End: Original strand, 10776150 - 10776198
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
10776198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7272421 - 7272468
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7272421 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
7272468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14238752 - 14238799
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14238752 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14238799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29158355 - 29158402
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29158355 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29158402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 9496342 - 9496396
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9496342 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 10776498 - 10776444
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
10776498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10776444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 14495070 - 14495124
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
14495070 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
14495124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 25600231 - 25600285
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25600231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 42132865 - 42132919
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42132865 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 1526171 - 1526115
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
1526171 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt |
1526115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 8094480 - 8094536
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| | |||||| |
|
|
| T |
8094480 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggt |
8094536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 389
Target Start/End: Original strand, 16643662 - 16643749
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
16643662 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaa |
16643749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 16644043 - 16643987
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
16644043 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggt |
16643987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 19494412 - 19494356
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
19494412 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19494356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 22917565 - 22917621
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
22917565 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22917621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 38930663 - 38930607
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38930663 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt |
38930607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1525810 - 1525857
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1525810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1525857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1778565 - 1778612
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1778565 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1778612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3512265 - 3512218
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3512265 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3512218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4375693 - 4375740
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4375693 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 7186003 - 7185956
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7186003 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
7185956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7420231 - 7420278
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7420231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
7420278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 8298588 - 8298635
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8298588 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8298635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 8298974 - 8298927
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8298974 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8298927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10337120 - 10337167
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10337120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10337167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 11019521 - 11019568
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11019521 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
11019568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 14239079 - 14239032
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14239079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14239032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 14489072 - 14489025
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14489072 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
14489025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15719657 - 15719704
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15719657 |
gctaaaatatggttttagtccctgcaaatatatctcgttttggtttta |
15719704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 16789368 - 16789321
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16789368 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16789321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22650465 - 22650512
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22650465 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
22650512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24187896 - 24187849
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24187896 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
24187849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24955009 - 24954962
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24955009 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
24954962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 27341590 - 27341543
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27341590 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
27341543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 32418319 - 32418366
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32418319 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32418366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 32725908 - 32725955
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32725908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
32725955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 34963663 - 34963616
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34963663 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
34963616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35097329 - 35097376
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35097329 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35097376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35346630 - 35346677
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35346630 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35346677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35346997 - 35346950
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35346997 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35346950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40492961 - 40493008
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40492961 |
gctaaaatatggttttagtacctgcaaatatgtctcgttttggtttta |
40493008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 42133153 - 42133106
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42133153 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42133106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 43477164 - 43477211
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43477164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43477211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 13155250 - 13155196
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
13155250 |
gctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctg |
13155196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 18549571 - 18549525
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggtttta |
18549525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 21125720 - 21125774
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21125720 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
21125774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 35345616 - 35345562
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35345616 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctg |
35345562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 40066498 - 40066552
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
40066498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctg |
40066552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 1685117 - 1685162
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1685162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 10755527 - 10755478
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
10755527 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaat |
10755478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 11976733 - 11976688
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
11976688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 13232201 - 13232246
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13232246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 30337216 - 30337171
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30337216 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 36044791 - 36044742
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggttttaat |
36044742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 40844532 - 40844487
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggtttta |
40844487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1408006 - 1408053
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
1408006 |
gctaaaatatggttttagtccatgcaaatatgtctcgttttagtttta |
1408053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 2728233 - 2728280
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2728233 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
2728280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2728596 - 2728549
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
2728596 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2728549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4017299 - 4017252
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
4017299 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
4017252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4473705 - 4473752
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
4473705 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
4473752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4710219 - 4710172
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
4710219 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4710172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 6146517 - 6146564
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6146564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 6146948 - 6146901
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
6146901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 7272750 - 7272703
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
7272750 |
gctaaaatatggttttagcccctgcaaatatgcctcgttttggtttta |
7272703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 7326420 - 7326373
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
7326420 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
7326373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 8094840 - 8094793
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
8094840 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
8094793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 11019856 - 11019809
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
11019856 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11019809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 11976374 - 11976421
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
11976374 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11976421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 17073808 - 17073855
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
17073808 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17073855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 17574462 - 17574415
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
17574462 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17574415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 18549202 - 18549249
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18549202 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
18549249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20984147 - 20984194
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
20984147 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
20984194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 20984509 - 20984462
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
20984509 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
20984462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24090487 - 24090440
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24090440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25131446 - 25131399
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
25131446 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
25131399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28346395 - 28346442
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28346395 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28346757 - 28346710
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28346757 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29158668 - 29158621
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
29158668 |
gctaaaatatggttttaatccctgcaaatatatctcgttttggtttta |
29158621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29488109 - 29488062
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29488109 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
29488062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 32726270 - 32726223
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
32726270 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
32726223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 33526411 - 33526364
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33526411 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
33526364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 33636323 - 33636370
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33636323 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
33636370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 34963301 - 34963348
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
34963301 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
34963348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35097691 - 35097644
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35097691 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35097644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 37536087 - 37536134
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
37536087 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
37536134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 40066819 - 40066772
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
40066819 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
40066772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40844157 - 40844204
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40844157 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
40844204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 42430119 - 42430072
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42430119 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
42430072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 6469281 - 6469335
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
6469281 |
gctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg |
6469335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
13779197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Complemental strand, 14495391 - 14495342
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
14495391 |
atgctaaaatatggtnttagtccccgcaaatatgcctcgttttggtttta |
14495342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 43727431 - 43727386
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggtttta |
43727386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 44997932 - 44997986
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
44997932 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctg |
44997986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 2811778 - 2811733
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
2811733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 355
Target Start/End: Original strand, 23939548 - 23939601
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||| |||||| ||||| |
|
|
| T |
23939548 |
gctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcct |
23939601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 1162910 - 1162966
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||| | |||||| |
|
|
| T |
1162910 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
1162966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 301 - 349
Target Start/End: Complemental strand, 13779532 - 13779484
Alignment:
| Q |
301 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13779532 |
tgctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
13779484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 346
Target Start/End: Complemental strand, 40493156 - 40493112
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
346 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40493156 |
gctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1408352 - 1408305
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
1408352 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
1408305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 1778917 - 1778874
Alignment:
| Q |
313 |
gttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctg |
1778874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3511907 - 3511954
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
3511907 |
gctaaaatatggttttggtcccttcaaatatgcctcgttttggtttta |
3511954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4474043 - 4473996
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4474043 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
4473996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4621353 - 4621306
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
4621353 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
4621306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5357424 - 5357471
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5357424 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
5357471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7326087 - 7326134
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
7326087 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggtttta |
7326134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 7420589 - 7420542
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
7420589 |
gctaaaatatggttttggtcactgcaaatatgcctcgttttggtttta |
7420542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 9175013 - 9175060
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||||| |
|
|
| T |
9175013 |
gctaaaatatgattttggtccttgcaaatatgtctcgttttggtttta |
9175060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9496722 - 9496675
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
9496722 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
9496675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10337448 - 10337401
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
10337448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
10337401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10540781 - 10540734
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10540781 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
10540734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10872916 - 10872963
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10872916 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
10872963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10873279 - 10873232
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
10873279 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
10873232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13232561 - 13232514
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
13232561 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
13232514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14488717 - 14488764
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
14488717 |
gctaaaatatagttttagtccctgaaaatatgcctcgttttggtttta |
14488764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14496817 - 14496864
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
14496817 |
gctaaaatatggttttagttcctgcaaatatgcgtcgttttggtttta |
14496864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19962996 - 19963043
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
19962996 |
gctaaaatatggtgttagtccttgcaaatatgtctcgttttagtttta |
19963043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20277693 - 20277740
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
20277693 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
20277740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 20278056 - 20278009
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||||||||||||||| |
|
|
| T |
20278056 |
gctaaaatatggttttggtccctgcagatatgcctcgttttggtttta |
20278009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21064320 - 21064367
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
21064320 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
21064367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 21064683 - 21064636
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||||||||||||||| |
|
|
| T |
21064683 |
gctaaaatatggttttggtccctgcagatatgcctcgttttggtttta |
21064636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24187570 - 24187617
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
24187570 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggtttta |
24187617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24815067 - 24815020
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
24815067 |
gctaaaatatggttttggcccctgcaaatatgtctcattttggtttta |
24815020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25600596 - 25600549
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
25600596 |
gctaaaatatagttttggtccctgcaaatatgtcttgttttggtttta |
25600549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 27117754 - 27117801
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
27117754 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
27117801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28258240 - 28258193
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
28258240 |
gctaaaatatggttttaacctctgcaaatatgtctcgttttggtttta |
28258193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28323850 - 28323897
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
28323850 |
gctaaaatatggttgtagtccctgcaaatatgcttcgttttggtttta |
28323897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28324180 - 28324133
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
28324180 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
28324133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28399034 - 28398987
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
28399034 |
gctaaaatatgattttagtccctgcaaatatggttcgttttggtttta |
28398987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29487751 - 29487798
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
29487751 |
gctaaaatatgattttcgtccctgcaaatatgtttcgttttggtttta |
29487798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 32040076 - 32040123
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| | ||||||||||||||||||| |||||||||||||| |
|
|
| T |
32040076 |
gctaaaatatgatcttagtccctgcaaatatgtttcgttttggtttta |
32040123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 33526053 - 33526100
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
33526053 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggtttta |
33526100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 37536418 - 37536371
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
37536418 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37536371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 27117975 - 27117929
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
27117975 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 35115638 - 35115592
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
35115638 |
gctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 9175368 - 9175323
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
9175323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 343
Target Start/End: Original strand, 9908919 - 9908960
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
9908919 |
gctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 15930931 - 15930980
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||| || ||| |||||||||||||||||||||||| |
|
|
| T |
15930931 |
atgctaaaatatgattttggttcctacaaatatgtctcgttttggtttta |
15930980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 28497616 - 28497571
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
28497571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 30969397 - 30969446
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||| |||||||||||||| |
|
|
| T |
30969397 |
atgctaaaatatggttttggtccttacaaatatgtttcgttttggtttta |
30969446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 33652193 - 33652238
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagtttta |
33652238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 303 - 356
Target Start/End: Original strand, 43727097 - 43727150
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| ||||| |||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctg |
43727150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 25702808 - 25702768
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
25702808 |
gctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1163273 - 1163226
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | |||||| |||||| |
|
|
| T |
1163273 |
gctaaaatatggttttagtccatgcaaatatgccccgttttagtttta |
1163226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 306 - 349
Target Start/End: Original strand, 3680532 - 3680575
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggtttta |
3680575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 333
Target Start/End: Complemental strand, 4376009 - 4375978
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4376009 |
gctaaaatatggttttagtccctgcaaatatg |
4375978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5357762 - 5357715
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggtttta |
5357715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10540450 - 10540497
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
10540450 |
gctaaaatattgttttggtctctgcaaatatgcctcgttttggtttta |
10540497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 21126020 - 21125973
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
21126020 |
gctaaaatatagttttagtccatgtaaatatgactcgttttggtttta |
21125973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 306 - 349
Target Start/End: Original strand, 24814710 - 24814753
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggtttta |
24814753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 333
Target Start/End: Original strand, 28398757 - 28398788
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28398757 |
gctaaaatatggttttagtccctgcaaatatg |
28398788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28497256 - 28497303
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
28497256 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttagtttta |
28497303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35143843 - 35143796
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| ||| || ||||||| ||||||||||||||| |
|
|
| T |
35143843 |
gctaaaatatggttttaatccgtgtaaatatgcctcgttttggtttta |
35143796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44998262 - 44998215
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
44998262 |
gctaaaatatggttttgatctctacaaatatgtctcgttttggtttta |
44998215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 3680800 - 3680754
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
3680800 |
gctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt |
3680754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 9175298 - 9175264
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
9175298 |
ttttggtccctgcaaatatgtctcgttttggtttt |
9175264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 9832216 - 9832270
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||| | |||||||||||||| |||| |
|
|
| T |
9832216 |
gctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctg |
9832270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 13779462 - 13779428
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
13779462 |
ttttggtccctgcaaatatgtctcgttttggtttt |
13779428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 356
Target Start/End: Original strand, 26530673 - 26530723
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| |||| |||||| |||||| |
|
|
| T |
26530673 |
aaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg |
26530723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 322 - 352
Target Start/End: Complemental strand, 32195623 - 32195593
Alignment:
| Q |
322 |
cctgcaaatatgtctcgttttggttttaatt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32195623 |
cctgcaaatatgtctcgttttggttttaatt |
32195593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 13796593 - 13796548
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggtttta |
13796548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 14848186 - 14848142
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggtttta |
14848142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 15719978 - 15719929
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
15719978 |
gctaaaatataattttagtttctgcaaatatgtcttgttttggttttaat |
15719929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 336
Target Start/End: Original strand, 16010596 - 16010629
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtct |
336 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
16010596 |
ctaaaatattgttttagtccctgcaaatatgtct |
16010629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 17574105 - 17574150
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatatgtcgggttttgatttta |
17574150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 29991918 - 29991963
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| |||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagtttta |
29991963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 305 - 349
Target Start/End: Complemental strand, 17074164 - 17074120
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
17074164 |
aaaatatggttttggtccctgcaaatatgtcgggttttgatttta |
17074120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 342
Target Start/End: Original strand, 25702513 - 25702553
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
25702513 |
gctaaaatatggttttggtccctgtaaatatgcctcgtttt |
25702553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 342
Target Start/End: Original strand, 32195281 - 32195321
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| |||| |
|
|
| T |
32195281 |
gctaaaatatggttttggtccctacaaatatgtctcatttt |
32195321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 1e-23; HSPs: 196)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 302 - 389
Target Start/End: Complemental strand, 41358662 - 41358575
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
41358662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaa |
41358575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 32626530 - 32626584
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32626530 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
32626584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 302 - 355
Target Start/End: Complemental strand, 45638893 - 45638840
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45638893 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcct |
45638840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 389
Target Start/End: Complemental strand, 990378 - 990291
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
990378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaa |
990291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 304 - 356
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18899894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 45290458 - 45290514
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
45290458 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
45290514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 6567495 - 6567448
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6567495 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
6567448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13260320 - 13260273
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13260320 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13260273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14007490 - 14007537
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14007490 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14007537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19622656 - 19622703
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19622656 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19622703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21391097 - 21391144
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21391097 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
21391144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22953555 - 22953508
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22953555 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22953508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26191733 - 26191686
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26191733 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26191686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26442564 - 26442611
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26442564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26442611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 48609593 - 48609546
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48609593 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48609546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 12322969 - 12322915
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12322969 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
12322915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 33067729 - 33067675
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctg |
33067675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 35307716 - 35307770
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
35307716 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 39303673 - 39303722
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39303673 |
atgctaaaatatggttttagtccctgcaagtatgtctcgttttggtttta |
39303722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 7001896 - 7001840
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
7001896 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7001840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 303 - 351
Target Start/End: Complemental strand, 17130081 - 17130033
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaat |
17130033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 18473273 - 18473329
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
18473273 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18473329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 26061957 - 26062013
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
26061957 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26062013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 32729048 - 32728992
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
32729048 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
32728992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 41358370 - 41358426
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
41358370 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41358426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 41881094 - 41881150
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
41881094 |
gctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggt |
41881150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1810928 - 1810975
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1810928 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1810975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3247199 - 3247246
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3247199 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3247246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3753214 - 3753261
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3753261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 8140435 - 8140482
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8140435 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8140482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10631165 - 10631212
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10631165 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10631212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10887597 - 10887550
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10887597 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10887550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 11822005 - 11822052
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11822005 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
11822052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 11822364 - 11822317
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11822364 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgctttta |
11822317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 12360967 - 12360920
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12360967 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12360920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13770490 - 13770537
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13770490 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13770537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 15526361 - 15526314
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15526361 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
15526314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18302386 - 18302339
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18302386 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18302339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18473594 - 18473547
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18473594 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18473547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19720713 - 19720760
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19720713 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19720760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22919685 - 22919732
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22919685 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22919732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24649351 - 24649398
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24649351 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24649398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24654166 - 24654119
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24654166 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24654119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24977779 - 24977826
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24977779 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24977826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 27521577 - 27521624
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
27521624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29072498 - 29072545
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29072498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29072545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30322930 - 30322977
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30322930 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
30322977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 33000668 - 33000621
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33000668 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
33000621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 33379889 - 33379936
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33379889 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33379936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 34002939 - 34002892
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34002939 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
34002892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35005743 - 35005696
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35005743 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35005696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35056531 - 35056578
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35056531 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35056578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35308110 - 35308063
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35308110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35308063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 39747834 - 39747787
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39747834 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
39747787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40718111 - 40718158
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40718111 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
40718158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 44641079 - 44641126
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44641126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 45368491 - 45368538
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45368491 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45368538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 45380273 - 45380320
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45380273 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45380320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46868576 - 46868529
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46868576 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
46868529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 48609237 - 48609284
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48609237 |
gctaaaatatggttttagtcccggcaaatatgtctcgttttggtttta |
48609284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 4789310 - 4789356
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4789356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 25658015 - 25658069
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
25658015 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg |
25658069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 304 - 358
Target Start/End: Complemental strand, 26062255 - 26062201
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggt |
26062201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 33067349 - 33067395
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33067349 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 50428874 - 50428928
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
50428874 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg |
50428928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 7350426 - 7350471
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggtttta |
7350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 18900130 - 18900085
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggtttta |
18900085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 34808200 - 34808245
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggtttta |
34808245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 38150851 - 38150896
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
38150896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 49073692 - 49073741
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
49073692 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaat |
49073741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 990089 - 990145
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||| | |||||| |
|
|
| T |
990089 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggt |
990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 301 - 349
Target Start/End: Original strand, 15058418 - 15058466
Alignment:
| Q |
301 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
15058418 |
tgctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
15058466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 304 - 356
Target Start/End: Complemental strand, 15335292 - 15335240
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
15335240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 19623016 - 19622960
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
19623016 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
19622960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 31258340 - 31258396
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||| | |||||| |
|
|
| T |
31258340 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
31258396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 45290819 - 45290763
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||| | |||||| |
|
|
| T |
45290819 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
45290763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3679627 - 3679674
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3679627 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
3679674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3753571 - 3753524
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
3753571 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
3753524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4323829 - 4323876
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
4323876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4360625 - 4360578
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4360625 |
gctaaaatatggttttagtccctgcaaatatgtctcgttggggtttta |
4360578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7818783 - 7818830
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
7818830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7867130 - 7867177
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
7867130 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
7867177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10631527 - 10631480
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
10631527 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
10631480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10887234 - 10887281
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
10887234 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
10887281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12361012 - 12361059
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
12361012 |
gctaaaatatggttttagtccctgcaaatttgcctcgttttggtttta |
12361059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13259989 - 13260036
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
13259989 |
gctaaaatatggttttagtcgctgcaaatatggctcgttttggtttta |
13260036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15211512 - 15211559
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
15211512 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
15211559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 16083048 - 16083095
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
16083048 |
gctaaaatatggttttagtccccgcaaatatgtctcgtttttgtttta |
16083095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 17984334 - 17984381
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
17984334 |
gctaaaatatggtttgagtccctgcaaatatgcctcgttttggtttta |
17984381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 17984700 - 17984653
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17984700 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
17984653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21383105 - 21383152
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21383105 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggtttta |
21383152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24507842 - 24507795
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
24507842 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24507795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24653803 - 24653850
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
24653803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24653850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26191360 - 26191407
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26191360 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
26191407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26442898 - 26442851
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
26442898 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
26442851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29072861 - 29072814
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
29072861 |
gctaaaatatggttttagtccctgcaaatatgcctcgctttggtttta |
29072814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29688427 - 29688380
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29688427 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
29688380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31060788 - 31060835
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
31060788 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
31060835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 32420099 - 32420146
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
32420146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 32454293 - 32454246
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
32454293 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggcttta |
32454246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 33045689 - 33045642
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
33045689 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
33045642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35005445 - 35005492
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
35005445 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
35005492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 37545629 - 37545676
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37545629 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
37545676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 38151211 - 38151164
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
38151211 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38151164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 38164294 - 38164247
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
38164294 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38164247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 42482980 - 42483027
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42482980 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
42483027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 44157696 - 44157743
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
44157743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44641431 - 44641384
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44641431 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
44641384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 47819233 - 47819280
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
47819233 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 47819595 - 47819548
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
47819595 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 48955715 - 48955762
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48955715 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
48955762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 48956065 - 48956018
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
48956065 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
48956018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 50429208 - 50429161
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50429208 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
50429161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 50799131 - 50799178
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
50799131 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
50799178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 52254184 - 52254231
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
52254184 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
52254231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 52254478 - 52254431
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
52254478 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
52254431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 26207280 - 26207326
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
26207326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 304 - 358
Target Start/End: Complemental strand, 31258699 - 31258645
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| | |||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt |
31258645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 37624747 - 37624793
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
37624747 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 3247559 - 3247514
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3247514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 343
Target Start/End: Complemental strand, 18079659 - 18079618
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18079659 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 343
Target Start/End: Original strand, 36912854 - 36912895
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36912854 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 38163934 - 38163979
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38163979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 305 - 349
Target Start/End: Complemental strand, 24649656 - 24649612
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
24649612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 346
Target Start/End: Complemental strand, 37625026 - 37624982
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
346 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggtt |
37624982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 304 - 348
Target Start/End: Original strand, 39025112 - 39025156
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
39025156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 349
Target Start/End: Original strand, 2939934 - 2939977
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
2939977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3679985 - 3679938
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3679985 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
3679938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 304 - 351
Target Start/End: Complemental strand, 4324163 - 4324116
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||| ||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggttttaat |
4324116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 7819102 - 7819055
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
7819102 |
gctaaaatatggttttaatctctgcaaatatgcctcgttttggtttta |
7819055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 7867356 - 7867309
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7867356 |
gctaaaatatggttttggtccctgcaaatatgtcttattttggtttta |
7867309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 8140798 - 8140751
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||||||| |
|
|
| T |
8140798 |
gctaaaatatggttttggtacctgcaaatatgcctcgttttggtttta |
8140751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12158691 - 12158738
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
12158691 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttggtttta |
12158738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 15058765 - 15058718
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15058765 |
gctaaaatattgttttgatccctgcaaatatgtctcgttttggtttta |
15058718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 353
Target Start/End: Original strand, 15334918 - 15334969
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattc |
353 |
Q |
| |
|
||||||||||||||||| || ||| ||||||| ||||||||||||||||||| |
|
|
| T |
15334918 |
gctaaaatatggttttaatctctgtaaatatgactcgttttggttttaattc |
15334969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15516583 - 15516630
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
15516583 |
gctaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
15516630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 16026937 - 16026890
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
16026937 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16026890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 16060884 - 16060837
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
16060884 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16060837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20948756 - 20948803
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||| ||||||| |
|
|
| T |
20948756 |
gctaaaatatggttttggtccctacaaatatgtctcgtttgggtttta |
20948803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22674204 - 22674251
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
22674204 |
gctaaaatatggtttaggtccatgcaaatatgtctcgttttggtttta |
22674251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22919976 - 22919929
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
22919976 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttagtttta |
22919929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24507480 - 24507527
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24507480 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
24507527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26324586 - 26324633
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
26324586 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
26324633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26324946 - 26324899
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
26324946 |
gctaaaatatgattttagtccatgcaaatatgcctcgttttggtttta |
26324899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30323292 - 30323245
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
30323292 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
30323245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31061150 - 31061103
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
31061150 |
gctaaaatatggttttgatccctgcaaatatatctcgttttggtttta |
31061103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 33000306 - 33000353
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
33000306 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
33000353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 33234547 - 33234594
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
33234547 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
33234594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35056893 - 35056846
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35056893 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
35056846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 38136980 - 38136933
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
38136980 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
38136933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44158041 - 44157994
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
44158041 |
gctaaaatatggtttttgtccctgcaaatatgcctagttttggtttta |
44157994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 45380635 - 45380588
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
45380635 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
45380588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 45638581 - 45638628
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45638581 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
45638628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 8364915 - 8364869
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
8364915 |
gctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt |
8364869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 15211857 - 15211803
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| ||| |||| |
|
|
| T |
15211857 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 34002636 - 34002682
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
34002636 |
gctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 45368847 - 45368801
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggtttta |
45368801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 46183686 - 46183732
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
46183732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 4360299 - 4360343
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
4360299 |
taaaatatggttttagtcc-tgcaaatatgtcttgttttggtttta |
4360343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 8364619 - 8364664
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggtttta |
8364664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 19721071 - 19721026
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
19721026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 21391371 - 21391326
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagtttta |
21391326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 341
Target Start/End: Original strand, 34382946 - 34382987
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34382946 |
atgctaaaatatggttttagtccctgcaaatatacctcgttt |
34382987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 41739119 - 41739075
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41739119 |
gctaaaatatggttttagtccctgcaaatat---tcgttttggtttta |
41739075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 4565335 - 4565295
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4565335 |
gctaaaatatggttctggtccctgcaaatatgtctcgtttt |
4565295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 32035787 - 32035747
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
32035787 |
gctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 310 - 349
Target Start/End: Original strand, 292868 - 292907
Alignment:
| Q |
310 |
atggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgctttta |
292907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12322605 - 12322652
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
12322605 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttgatttta |
12322652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12360604 - 12360651
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
12360604 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagtttta |
12360651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 16060597 - 16060643
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
16060597 |
gctaaaatatggttttggtccct-caaatatgcctcgttttggtttta |
16060643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 16083394 - 16083351
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgatttta |
16083351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 318 - 349
Target Start/End: Original strand, 18302070 - 18302101
Alignment:
| Q |
318 |
agtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggtttta |
18302101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18928141 - 18928094
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| |||| |||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagtttta |
18928094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24510307 - 24510260
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
24510307 |
gctaaaatatggttttggtccctgcaaatatggttcgttttagtttta |
24510260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28507457 - 28507410
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
28507457 |
gctaaaatattgttttggtccctgcaaatatgtctcattttagtttta |
28507410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 33045356 - 33045403
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
33045356 |
gctaaaatttggttttggtccctgcaaatatgcctagttttggtttta |
33045403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 33234911 - 33234864
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
33234911 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
33234864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 39025380 - 39025334
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
39025380 |
gctaaaatatggttttggtccctgcaaa-atgcctcgttttggtttta |
39025334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 39747475 - 39747521
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
39747475 |
gctaaaatatggttttggtcc-tgcaaatacgtctcgttttggtttta |
39747521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 41738797 - 41738844
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
41738797 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagtttta |
41738844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 17129691 - 17129737
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggtttta |
17129737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 22953258 - 22953304
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggattta |
22953304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 24978121 - 24978067
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
24978121 |
gctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg |
24978067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 26324874 - 26324840
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggtttt |
26324840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 304 - 342
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgtttt |
31404467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 307 - 349
Target Start/End: Original strand, 32035442 - 32035484
Alignment:
| Q |
307 |
aatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggtttta |
32035484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 42483270 - 42483224
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
42483270 |
gctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 48730615 - 48730569
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| |||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgtttta |
48730569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 4617091 - 4617136
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| ||||||| |||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagtttta |
4617136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 5058989 - 5058944
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||| ||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgatttta |
5058944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 7350733 - 7350688
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggtttta |
7350688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 20756022 - 20756067
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| ||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggtttta |
20756067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 343
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 32906237 - 32906192
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttgatttta |
32906192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 33380256 - 33380208
Alignment:
| Q |
302 |
gctaaaatatggttttagtccc-tgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| ||||||||||||||| |
|
|
| T |
33380256 |
gctaaaatatggttttagccccctacaaatatgcctcgttttggtttta |
33380208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 304 - 348
Target Start/End: Complemental strand, 46184051 - 46184007
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggtttt |
46184007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 3e-21; HSPs: 216)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 302 - 389
Target Start/End: Original strand, 39436719 - 39436806
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
39436719 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaa |
39436806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 30130159 - 30130213
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30130159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
30130213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 389
Target Start/End: Complemental strand, 3152110 - 3152023
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
3152110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaa |
3152023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 389
Target Start/End: Original strand, 51834609 - 51834696
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
51834609 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaattttgtttttggtccctgcaaaa |
51834696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4814541 - 4814588
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4814541 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22008527 - 22008574
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22008527 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22008574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22016045 - 22016092
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016045 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22016092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 34238599 - 34238646
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34238599 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
34238646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 39288574 - 39288621
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288574 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39288621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 53701662 - 53701615
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53701662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
53701615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 474407 - 474353
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
474407 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 21159816 - 21159762
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
21159816 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
21159762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 43441271 - 43441325
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43441271 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 10976979 - 10977035
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
10976979 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
10977035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 20612897 - 20612841
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
20612897 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
20612841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 22155930 - 22155986
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
22155930 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt |
22155986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 22156292 - 22156236
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22156236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 28427246 - 28427302
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| | |||||| |
|
|
| T |
28427246 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt |
28427302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 28427607 - 28427551
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
28427607 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
28427551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 37506868 - 37506924
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
37506868 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37506924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 39437108 - 39437052
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
39437108 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39437052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 40169653 - 40169597
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
40169653 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt |
40169597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 474045 - 474092
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
474045 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
474092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3151751 - 3151798
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3151751 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3151798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3830515 - 3830468
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3830515 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3830468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4034718 - 4034765
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4034718 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4034765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4513264 - 4513311
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4513264 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4513311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4513619 - 4513572
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4513619 |
gctaaaatatggttttactccctgcaaatatgtctcgttttggtttta |
4513572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4950038 - 4950085
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4950038 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4950085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12740908 - 12740955
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12740908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12740955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 12741270 - 12741223
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12741270 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12741223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21159454 - 21159501
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21159454 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
21159501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25710869 - 25710822
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25710869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25710822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26090077 - 26090030
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26090077 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
26090030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29446205 - 29446158
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29446205 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
29446158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29490742 - 29490695
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29490742 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
29490695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29525106 - 29525153
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29525106 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
29525153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31869955 - 31869908
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31869955 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
31869908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 37507221 - 37507174
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37507221 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37507174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 47336580 - 47336533
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47336580 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
47336533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 51550445 - 51550398
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51550445 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
51550398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 54608862 - 54608815
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54608862 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
54608815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 7518444 - 7518398
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggtttta |
7518398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 14633547 - 14633593
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14633593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 356
Target Start/End: Complemental strand, 29955661 - 29955611
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
29955611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 356
Target Start/End: Complemental strand, 30004816 - 30004766
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
30004766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 30128285 - 30128339
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
30128285 |
gctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg |
30128339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 40979709 - 40979655
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40979709 |
gctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctg |
40979655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 44802283 - 44802337
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
44802283 |
gctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg |
44802337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 45002022 - 45002076
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
45002022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 50196301 - 50196347
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
50196347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 35569133 - 35569088
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35569088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 303 - 356
Target Start/End: Complemental strand, 45006247 - 45006194
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
45006194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 45161116 - 45161161
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggtttta |
45161161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 8510215 - 8510271
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| | |||||| |
|
|
| T |
8510215 |
gctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggt |
8510271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 13584366 - 13584310
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| | |||||| |
|
|
| T |
13584366 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
13584310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 14633888 - 14633832
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||| | |||||| |
|
|
| T |
14633888 |
gctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
14633832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 26799889 - 26799945
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||| | |||||| |
|
|
| T |
26799889 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
26799945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 389
Target Start/End: Original strand, 28942526 - 28942613
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| || |||| |||||||||||||||||||||| |
|
|
| T |
28942526 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtttttggtaaaaaaaaatttgtttttggtccctgcaaaa |
28942613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 28942904 - 28942848
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
28942904 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt |
28942848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 39288897 - 39288841
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
39288897 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
39288841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 40169345 - 40169401
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
40169345 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggt |
40169401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 51834941 - 51834885
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| | |||||| |
|
|
| T |
51834941 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
51834885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3361817 - 3361770
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
3361770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3830135 - 3830182
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
3830135 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
3830182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4814897 - 4814851
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4814897 |
gctaaaatatggttttagtcc-tgcaaatatgtctcgttttggtttta |
4814851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5345688 - 5345641
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5345688 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
5345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 307 - 358
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
| Q |
307 |
aatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| | |||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
8510472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9262154 - 9262107
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
9262154 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9262107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9863403 - 9863356
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
9863403 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
9863356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15016389 - 15016436
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
15016389 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
15016436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 15979700 - 15979653
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
15979700 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
15979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 16123140 - 16123187
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
16123140 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
16123187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 18175792 - 18175844
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
18175792 |
gctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctg |
18175844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20611021 - 20611068
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20611021 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
20611068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22008889 - 22008842
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
22008889 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22008842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 25615976 - 25616023
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25615976 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25616023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 349
Target Start/End: Original strand, 25710515 - 25710558
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgatttta |
25710558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28552382 - 28552335
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28552382 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28552335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29445955 - 29446002
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29445955 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29446002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30268506 - 30268553
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30268506 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30268553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30424629 - 30424676
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
30424629 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttagtttta |
30424676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30552477 - 30552430
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30552477 |
gctaaaatatcgttttagtccatgcaaatatgtctcgttttggtttta |
30552430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31480137 - 31480184
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
31480137 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
31480184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35177256 - 35177303
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35177256 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
35177303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 40370588 - 40370541
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
40370588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40370541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 43440496 - 43440543
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
43440496 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
43440543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 45320978 - 45320931
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45320978 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
45320931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46186770 - 46186723
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
46186770 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
46186723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 46751272 - 46751319
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
46751272 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
46751319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 46901105 - 46901152
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
46901105 |
gctaaaatatggttttagtctctgcaaatatgtatcgttttggtttta |
46901152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 47005155 - 47005202
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
47005155 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagtttta |
47005202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 47114488 - 47114535
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47114488 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
47114535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 49323783 - 49323830
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
49323783 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
49323830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 51500684 - 51500637
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
51500684 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51500637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 51550083 - 51550130
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
51550083 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
51550130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 51759820 - 51759867
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
51759820 |
gctaaaatatggttctagttcctgcaaatatgtctcgttttggtttta |
51759867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 51760117 - 51760070
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51760070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 54608519 - 54608566
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
54608519 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
54608566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 4035052 - 4034998
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
4035052 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 29955300 - 29955346
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
29955346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 30004454 - 30004500
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
30004500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 31869596 - 31869642
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggtttta |
31869642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 39072212 - 39072158
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
39072212 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctg |
39072158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 40370286 - 40370340
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
40370286 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg |
40370340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 53113444 - 53113490
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
53113444 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 3387268 - 3387313
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
3387313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 8940522 - 8940477
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8940477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 20757403 - 20757448
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
20757448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 46186408 - 46186457
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
46186408 |
atgctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
46186457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 49324143 - 49324098
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
49324098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 52342196 - 52342245
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
52342196 |
gctaaaatatggttttggtccctgcaaatatgcctccttttggttttaat |
52342245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 303 - 351
Target Start/End: Complemental strand, 2486900 - 2486852
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaat |
2486852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 10977340 - 10977284
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
10977340 |
gctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt |
10977284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 304 - 356
Target Start/End: Complemental strand, 45521833 - 45521781
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
45521781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 275445 - 275492
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
275445 |
gctaaaatatggttttagtccctgcaactatgcctcgttttgatttta |
275492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1721451 - 1721404
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1721451 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
1721404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3387603 - 3387556
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
3387603 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggtttta |
3387556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7518091 - 7518138
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||| |||||| |
|
|
| T |
7518091 |
gctaaaatatggtgttagtccctgcaaatatgcctcgtttttgtttta |
7518138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 9261790 - 9261837
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
9261790 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
9261837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 9603630 - 9603677
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9603630 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
9603677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9603918 - 9603871
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
9603918 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 11463233 - 11463280
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggtttta |
11463280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12673645 - 12673692
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
12673645 |
gctaaaatatagttttagtccctgtaaatatgcctcgttttggtttta |
12673692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13514576 - 13514529
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
13514576 |
gctaaaatatgattttggtacctgcaaatatgtctcgttttggtttta |
13514529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14772212 - 14772259
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14772212 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
14772259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15286157 - 15286204
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
15286157 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggtttta |
15286204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15979339 - 15979386
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15979339 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
15979386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19656542 - 19656589
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
19656542 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
19656589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19844580 - 19844533
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
19844580 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
19844533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21553890 - 21553937
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
21553890 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
21553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25610129 - 25610082
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
25610082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26089731 - 26089778
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26089731 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
26089778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28452148 - 28452195
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
28452148 |
gctaaaatatggttttggtccttgcaaatatgtcttgttttggtttta |
28452195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28552022 - 28552069
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
28552022 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
28552069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30034471 - 30034424
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
30034471 |
gctaaaatatggttttgctccttgcaaatatgtctcgttttggtttta |
30034424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30106219 - 30106172
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
30106219 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
30106172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31480499 - 31480452
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
31480499 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
31480452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 32119221 - 32119268
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
32119221 |
gctaaaatatagttttggtccctgcaaatatgtctcgttttagtttta |
32119268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 32119583 - 32119536
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
32119583 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
32119536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 34238914 - 34238867
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34238914 |
gctaaaatatggttttagtccccgcaaatatgcttcgttttggtttta |
34238867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 38232242 - 38232289
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
38232242 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttgatttta |
38232289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40545565 - 40545612
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
40545565 |
gctaaaatatggttttggtccctgcaaatatgactcgttttagtttta |
40545612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 43441602 - 43441555
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
43441602 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
43441555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 45002384 - 45002337
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
45002384 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
45002337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46622128 - 46622081
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
46622128 |
gctaaaatatggttttggtccttgcaaatatgtttcgttttggtttta |
46622081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 47005518 - 47005471
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
47005518 |
gctaaaatatggttttggtccctgcaaatattcctcgttttggtttta |
47005471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 47336229 - 47336276
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
47336229 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
47336276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 48924239 - 48924192
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
48924239 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
48924192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 50196656 - 50196609
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
50196656 |
gctaaaatatggttttagtccctacaaatatgcctcgtttttgtttta |
50196609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 50261935 - 50261888
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || ||||||||||| |
|
|
| T |
50261935 |
gctaaaatatcgttttagtccctgcaaatatgtttcattttggtttta |
50261888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 52342582 - 52342535
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
52342582 |
gctaaaatatggtttttgtctctgcaaatatgcctcgttttggtttta |
52342535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 2486581 - 2486627
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggtttta |
2486627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 27681681 - 27681627
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
27681681 |
gctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg |
27681627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 35498417 - 35498471
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
35498417 |
gctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg |
35498471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 35533281 - 35533327
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggtttta |
35533327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 43440785 - 43440739
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggtttta |
43440739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 304 - 358
Target Start/End: Original strand, 49670477 - 49670531
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||| ||||||||| |||||||||| || |||||||||||||| |||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggt |
49670531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 863649 - 863604
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgatttta |
863604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 1721092 - 1721137
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggtttta |
1721137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 4322186 - 4322141
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggtttta |
4322141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 9596757 - 9596806
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
9596757 |
atgctaaaatatggtttttgtctctgcaaatatgcatcgttttggtttta |
9596806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 9863050 - 9863094
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgc-aatatgcctcgttttggtttta |
9863094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 20907454 - 20907409
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggtttta |
20907409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 343
Target Start/End: Original strand, 25353200 - 25353241
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25353200 |
gctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 348
Target Start/End: Complemental strand, 25610061 - 25610024
Alignment:
| Q |
311 |
tggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggtttt |
25610024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 36672966 - 36673011
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggtttta |
36673011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 40545836 - 40545791
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggtttta |
40545791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 45005889 - 45005934
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgatttta |
45005934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 49670802 - 49670745
Alignment:
| Q |
302 |
gctaaaatatggttttagtccc-tgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||| | |||||| |
|
|
| T |
49670802 |
gctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggt |
49670745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 354
Target Start/End: Complemental strand, 275832 - 275780
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcc |
354 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||||||||| |||| |
|
|
| T |
275832 |
gctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttcc |
275780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 304 - 356
Target Start/End: Original strand, 10778373 - 10778425
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctg |
10778425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 303 - 351
Target Start/End: Original strand, 30034109 - 30034157
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaat |
30034157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 354
Target Start/End: Complemental strand, 36673244 - 36673192
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcc |
354 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||||||||| |||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagttcc |
36673192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 347
Target Start/End: Complemental strand, 38232594 - 38232554
Alignment:
| Q |
307 |
aatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggttt |
38232554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 863282 - 863329
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||||||||||| |||||| |
|
|
| T |
863282 |
gctaaaatatgattttggtccatgcaaatatgtctcgttttagtttta |
863329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7588319 - 7588366
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
7588319 |
gctaaaatatagttttggtccctgcaaatatgccttgttttggtttta |
7588366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 7957225 - 7957178
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7957225 |
gctaaaatatgattttggtccctgcaaatatgcgtcgttttggtttta |
7957178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9597094 - 9597047
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
9597094 |
gctaaaatatggttttgttccctgcaaatatgcttcgttttggtttta |
9597047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20644506 - 20644553
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
20644506 |
gctaaaatatagttttggtccctgcaaatatgtctcattttgatttta |
20644553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 333
Target Start/End: Complemental strand, 26800168 - 26800137
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26800168 |
gctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28418899 - 28418852
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | |||||| ||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgatttta |
28418852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28452375 - 28452328
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
28452375 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
28452328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29686545 - 29686592
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
29686545 |
gctagaatatggttttggtccatgcaaatatgtcttgttttggtttta |
29686592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 30130499 - 30130456
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
30130499 |
aaatatggttttagtcactgcaaatatgcctcattttggtttta |
30130456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30426225 - 30426179
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
30426225 |
gctaaaatatggttttagt-cctgcaaatatgcctcgttttgatttta |
30426179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35407789 - 35407742
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
35407789 |
gctaaaatatggttttgatccctgcaaatatgtcttgtttttgtttta |
35407742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35565509 - 35565556
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
35565509 |
gctaaaatatggttttgttccctgcaaatatacctcgttttggtttta |
35565556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40277823 - 40277870
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40277823 |
gctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta |
40277870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 345
Target Start/End: Complemental strand, 44802547 - 44802504
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
345 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
44802547 |
gctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 45313862 - 45313815
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
45313862 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttgatttta |
45313815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 51500399 - 51500446
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
51500399 |
gctaaaatatggttctagtctctgtaaatatgcctcgttttggtttta |
51500446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 4321947 - 4322001
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
4321947 |
gctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctg |
4322001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 7957154 - 7957120
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggtttt |
7957120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 16679678 - 16679724
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggtttta |
16679724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 28452303 - 28452269
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggtttt |
28452269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 39132834 - 39132800
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggtttt |
39132800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 44506583 - 44506629
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
44506583 |
gctaaaatatggttttagtccctgcaaatataacgagttttggtttt |
44506629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Original strand, 47005227 - 47005261
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
47005227 |
ttttggtccctgcaaatatgtctcgttttggtttt |
47005261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 47114741 - 47114707
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
47114741 |
tttttgtccctgcaaatatgtctcgttttggtttt |
47114707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 8555305 - 8555260
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggtttta |
8555260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 12673978 - 12673933
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| ||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggtttta |
12673933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 339
Target Start/End: Complemental strand, 26273823 - 26273786
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgt |
339 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
26273823 |
gctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 27200441 - 27200486
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||| |||| |||||| |
|
|
| T |
27200441 |
taaaatatggttttaatccctgcaaatatatctcattttagtttta |
27200486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 30552150 - 30552194
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
30552150 |
taaaatatggttttagacc-tgcaaatatgtcttgttttggtttta |
30552194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 35936781 - 35936830
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
35936781 |
gctaaaatatggttttggtccctacaaatatacttcgttttggttttaat |
35936830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 36732643 - 36732688
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||| |||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
36732643 |
taaaataaggttttggtccctgcaaatatgtcttattttggtttta |
36732688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 39132905 - 39132860
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| || | ||||||| |
|
|
| T |
39132905 |
gctaaaatatggttttggtccctgcaaatatgtttcatattggttt |
39132860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 332
Target Start/End: Original strand, 39819314 - 39819343
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatat |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39819314 |
ctaaaatatggttttagtccctgcaaatat |
39819343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 40723121 - 40723166
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||| |||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggtttta |
40723166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 47901803 - 47901848
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggtttta |
47901848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 54767524 - 54767479
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgatttta |
54767479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 330
Target Start/End: Complemental strand, 10792969 - 10792941
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaat |
330 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10792969 |
gctaaaatatggttttagtccctgcaaat |
10792941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 342
Target Start/End: Original strand, 19844266 - 19844306
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| |||||||| |
|
|
| T |
19844266 |
gctaaaatatggttttggtccctacaaatatgcctcgtttt |
19844306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 320 - 348
Target Start/End: Original strand, 20644584 - 20644612
Alignment:
| Q |
320 |
tccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20644584 |
tccctgcaaatatgtctcgttttggtttt |
20644612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 304 - 332
Target Start/End: Original strand, 20807800 - 20807828
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatat |
332 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatat |
20807828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 4e-20; HSPs: 164)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 29366948 - 29366894
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29366948 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
29366894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 6118498 - 6118442
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
6118498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggt |
6118442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 389
Target Start/End: Complemental strand, 29172885 - 29172798
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
29172885 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaagaatttgtttttggtccctgcaaaa |
29172798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26133412 - 26133365
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26133412 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26133365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31037740 - 31037693
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31037740 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 36577723 - 36577770
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36577723 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36577770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 5614529 - 5614475
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
5614529 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
5614475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 23381951 - 23382005
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
23381951 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
23382005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 40029142 - 40029196
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
40029142 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctg |
40029196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 25561998 - 25561949
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25561998 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaat |
25561949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 358
Target Start/End: Original strand, 29172523 - 29172580
Alignment:
| Q |
301 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
29172523 |
tgctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 302 - 355
Target Start/End: Original strand, 42994069 - 42994122
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
42994069 |
gctaaaatatggttttagtccctgcaaatatgactcgttttgattttaattcct |
42994122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 18633600 - 18633656
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
18633600 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 18633960 - 18633904
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
18633960 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggt |
18633904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 29151850 - 29151794
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
29151850 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggt |
29151794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 29875724 - 29875668
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
29875724 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29875668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 303 - 355
Target Start/End: Complemental strand, 35609635 - 35609583
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcct |
35609583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 38496781 - 38496725
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| | |||||| |
|
|
| T |
38496781 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
38496725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 45139 - 45186
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45139 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1381248 - 1381295
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1381248 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1381295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2032939 - 2032892
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2032939 |
gctaaattatggttttagtccctgcaaatatgtctcgttttggtttta |
2032892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 2217495 - 2217542
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2217495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2217853 - 2217806
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2217853 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 3850594 - 3850551
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
3850551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4203457 - 4203504
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4203457 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4203504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4203769 - 4203722
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4203769 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
4203722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5614167 - 5614214
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5614167 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
5614214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5917127 - 5917174
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5917127 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
5917174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5950177 - 5950224
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5950177 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5950224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7075573 - 7075620
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7075573 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7075620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10743725 - 10743772
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10743725 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10743772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10744053 - 10744006
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10744053 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
10744006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14318046 - 14318093
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14318046 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
14318093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 16038378 - 16038425
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16038378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16038425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 18046039 - 18046086
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18046039 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
18046086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18046347 - 18046300
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18046347 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18046300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18258526 - 18258479
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18258526 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
18258479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19565468 - 19565515
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19565468 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19565515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19685018 - 19685065
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19685018 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19685065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20690734 - 20690781
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20690734 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20690781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21124914 - 21124961
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21124914 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
21124961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24781990 - 24782037
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24781990 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggtttta |
24782037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28550828 - 28550875
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28550828 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28550875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28863511 - 28863558
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28863511 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28863837 - 28863790
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28863837 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29692745 - 29692792
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29692745 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29692792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30800495 - 30800542
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30800495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30800849 - 30800802
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30800849 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30888161 - 30888208
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30888161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
30888208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 33336025 - 33335978
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33336025 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
33335978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35167164 - 35167117
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35167164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35167117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35877051 - 35877004
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35877051 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35877004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35928457 - 35928410
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35928457 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35928410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 36578082 - 36578035
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36578082 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
36578035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 38962807 - 38962854
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38962807 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
38962854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 40029496 - 40029449
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40029496 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
40029449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 6912855 - 6912809
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
6912809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 10408929 - 10408985
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
10408929 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
10408985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 15635706 - 15635650
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||| | |||||| |
|
|
| T |
15635706 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
15635650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 25561706 - 25561762
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| | |||||| |
|
|
| T |
25561706 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggt |
25561762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 35166157 - 35166101
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
35166157 |
gctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggt |
35166101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 303 - 351
Target Start/End: Complemental strand, 38452394 - 38452346
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttaat |
38452346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 304 - 351
Target Start/End: Complemental strand, 45501 - 45454
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttaat |
45454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 293829 - 293876
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
293829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
293876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1105147 - 1105100
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1105147 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1105100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1381610 - 1381563
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1381610 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1381563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 2636670 - 2636717
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
2636670 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
2636717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2636992 - 2636945
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2636945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4736541 - 4736494
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
4736541 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
4736494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5917459 - 5917412
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5917459 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5917412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 6912498 - 6912545
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
6912498 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
6912545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9179919 - 9179872
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
9179919 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10409325 - 10409278
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10409325 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10409278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 11799457 - 11799410
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
11799457 |
gctaaaatatggttttagtccgtgcaaatatgcctcgttttggtttta |
11799410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13990894 - 13990847
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13990894 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
13990847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 17070862 - 17070815
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
17070862 |
gctaaaatatggttttagtccctacaaatatgtctcgttttcgtttta |
17070815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 304 - 351
Target Start/End: Original strand, 18286431 - 18286478
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggttttaat |
18286478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19565830 - 19565783
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
19565830 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19565783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19685379 - 19685332
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
19685379 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19685332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20660949 - 20660996
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
20660949 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20660996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 23382296 - 23382249
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
23382296 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
23382249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24443743 - 24443696
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
24443743 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24443696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26133184 - 26133231
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26133184 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
26133231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 388
Target Start/End: Original strand, 29875401 - 29875487
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaa |
388 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
29875401 |
gctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaa |
29875487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 34125308 - 34125355
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34125308 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
34125355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35166912 - 35166959
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
35166912 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
35166959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35928065 - 35928112
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35928065 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35928112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 37271705 - 37271658
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
37271705 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
37271658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 38170515 - 38170562
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
38170515 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38170562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 38786160 - 38786207
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38786160 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
38786207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 39379609 - 39379562
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39379609 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
39379562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40167787 - 40167834
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40167787 |
gctaaagtatggttttagtccctgcaaatatgcctcgttttggtttta |
40167834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 40168007 - 40167960
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40168007 |
gctaaaatattgttttagtccatgcaaatatgtctcgttttggtttta |
40167960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40764416 - 40764463
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
40764416 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40764463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 42207243 - 42207290
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
42207243 |
gctaaaatatggttttagtccttgtaaatatgtctcgttttggtttta |
42207290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 42553643 - 42553690
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42553643 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
42553690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 3850300 - 3850346
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
3850300 |
gctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 304 - 358
Target Start/End: Original strand, 15635379 - 15635433
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||| | |||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggt |
15635433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 16038738 - 16038692
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
16038692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 25779161 - 25779107
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
25779161 |
gctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg |
25779107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 27850372 - 27850326
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggtttta |
27850326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 28871993 - 28871939
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
28871993 |
gctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 32108809 - 32108863
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
32108809 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctg |
32108863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 304 - 358
Target Start/End: Original strand, 39379242 - 39379296
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39379296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 9532532 - 9532487
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9532487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 303 - 348
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 20416361 - 20416406
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
20416361 |
gctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt |
20416406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 20985728 - 20985773
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20985773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 27916761 - 27916716
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggtttta |
27916716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 304 - 356
Target Start/End: Complemental strand, 1287042 - 1286990
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg |
1286990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 29151517 - 29151573
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
29151517 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggt |
29151573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1104859 - 1104906
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
1104859 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
1104906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3851328 - 3851281
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3851328 |
gctaaaatatggttttagtccctcaaaatatgtctcgttttgatttta |
3851281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5104000 - 5103953
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
5104000 |
gctaaaatatggttttggttcctgcaaatatgtctcattttggtttta |
5103953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 9179594 - 9179641
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
9179594 |
gctaaaatatggttttagtccttgcaaatatgattcgttttggtttta |
9179641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 11799130 - 11799177
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
11799130 |
gctaaaatatggttttagtccctgcaaatatgcattgttttggtttta |
11799177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15916287 - 15916334
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
15916287 |
gctaaaagatggttttggtccctgcaaatatgtctcattttggtttta |
15916334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 341
Target Start/End: Original strand, 17070536 - 17070575
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttt |
341 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17070536 |
gctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 18258163 - 18258210
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
18258163 |
gctaaaatatggttttggtccctgcaaatatggctcattttggtttta |
18258210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18286740 - 18286693
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18286740 |
gctaaaaaatggttttagtccctgcaaatatacctcgttttggtttta |
18286693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 20986088 - 20986041
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
20986088 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
20986041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 21050912 - 21050865
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21050912 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttgatttta |
21050865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24443381 - 24443428
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
24443381 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
24443428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28213374 - 28213421
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
28213374 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28213421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29693089 - 29693042
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29693089 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
29693042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 34125631 - 34125584
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
34125631 |
gctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
34125584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35876689 - 35876736
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35876689 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
35876736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 36973354 - 36973401
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
36973354 |
gctaaaatatggttttggtctctccaaatatgtctcgttttggtttta |
36973401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 36973709 - 36973662
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
36973709 |
gctaaaatatggttttggtccctggaaatatgtctcgttttgatttta |
36973662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 37271360 - 37271407
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
37271360 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
37271407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 40764779 - 40764732
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
40764779 |
gctaaaatatggttttgctccctgcaaatatgcctcgttttggtttta |
40764732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 16616370 - 16616416
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
16616416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 40038857 - 40038803
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
40038857 |
gctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg |
40038803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 20418013 - 20417968
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgatttta |
20417968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 26071613 - 26071568
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
26071568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 27916460 - 27916509
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
27916460 |
atgctaaaatatgatcttagttcctgcaaatatgtttcgttttggtttta |
27916509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 28108159 - 28108114
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggtttta |
28108114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 38182086 - 38182041
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38182086 |
gctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 38189045 - 38189090
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38189045 |
gctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 38209312 - 38209267
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38209312 |
gctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 38216270 - 38216315
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38216270 |
gctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 40038495 - 40038544
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
40038495 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaat |
40038544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 42596814 - 42596769
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagtttta |
42596769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9588611 - 9588563
Alignment:
| Q |
302 |
gctaaaatatggttttag-tccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggtttta |
9588563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1286683 - 1286730
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| || |||||| |||||||| ||||||||||||||| |
|
|
| T |
1286683 |
gctaaaatatggtgttggtccctacaaatatgcctcgttttggtttta |
1286730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 345
Target Start/End: Original strand, 4736206 - 4736249
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
345 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
4736206 |
gctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12144908 - 12144955
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||| ||||||||||| |
|
|
| T |
12144908 |
gctaaaatatggtttttgtccctgtaaatatgcctctttttggtttta |
12144955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 20661310 - 20661263
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
20661310 |
gctaaaatatggttttggtccgtgcaaatatgcttcgttttggtttta |
20661263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20683748 - 20683795
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
20683748 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttgatttta |
20683795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22551318 - 22551271
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| | |||||||||||| |
|
|
| T |
22551318 |
gctaaaatatggttttagtctctgtaaatatgttttgttttggtttta |
22551271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26071292 - 26071339
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
26071292 |
gctaaaatatagtttcggtccctgcaaatatgtctcattttggtttta |
26071339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 314 - 349
Target Start/End: Original strand, 31602221 - 31602256
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggtttta |
31602256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35609304 - 35609351
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
35609304 |
gctaaaatatggttttggtccatgcaaatatgcatcgttttggtttta |
35609351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 10830530 - 10830584
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| || |||||||||||| |||||| |
|
|
| T |
10830530 |
gctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg |
10830584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 20691094 - 20691048
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||| || |||||||||||| ||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggtttta |
20691048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 22540098 - 22540152
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||| || | ||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
22540098 |
gctaaaatatgattatggtccccgcaaatatgtctcatttttgttttaattcctg |
22540152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 31037397 - 31037443
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgatttta |
31037443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 42207570 - 42207525
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggtttta |
42207525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 42596454 - 42596508
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||| |||||||||||| |||||| |
|
|
| T |
42596454 |
gctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctg |
42596508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 355
Target Start/End: Original strand, 5103649 - 5103702
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
||||||||||| |||| || | || ||||||| ||||||||||||||||||||| |
|
|
| T |
5103649 |
gctaaaatatgattttggttcatgtaaatatgactcgttttggttttaattcct |
5103702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 348
Target Start/End: Original strand, 22550960 - 22551005
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||||| | || |||||||||||||||| ||||| |
|
|
| T |
22550960 |
ctaaaatatggttttagtacatgtaaatatgtctcgttttagtttt |
22551005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 344
Target Start/End: Original strand, 6118139 - 6118175
Alignment:
| Q |
308 |
atatggttttagtccctgcaaatatgtctcgttttgg |
344 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgg |
6118175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 305 - 349
Target Start/End: Original strand, 32888691 - 32888735
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgtttta |
32888735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 38554752 - 38554797
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
38554752 |
gctaaaatatggttttgatccctgcaaata--tctcgttttggtttta |
38554797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 4e-20; HSPs: 177)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 9195055 - 9195109
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9195055 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 10375068 - 10375014
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10375068 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg |
10375014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 300 - 356
Target Start/End: Original strand, 10374773 - 10374829
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
10374773 |
atgctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 19183783 - 19183839
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
19183783 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
19183839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 26813867 - 26813923
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
26813867 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
26813923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5790898 - 5790851
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790898 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
5790851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10671940 - 10671893
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10671940 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10671893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 11713486 - 11713533
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11713486 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11713533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 11788415 - 11788368
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11788415 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11788368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 36622251 - 36622298
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622251 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36622298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 38639413 - 38639460
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38639413 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
38639460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 33733240 - 33733191
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33733240 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaat |
33733191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 16900205 - 16900149
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
16900205 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16900149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 16993596 - 16993540
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
16993596 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16993540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 19184150 - 19184094
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
19184150 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19184094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 26814228 - 26814172
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
26814228 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26814172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 37271740 - 37271796
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
37271740 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37271796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 37272101 - 37272045
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
37272101 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37272045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 38980252 - 38980196
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
38980252 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
38980196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4424184 - 4424137
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4424184 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4424137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13215061 - 13215108
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13215061 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13215108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 17541775 - 17541728
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17541775 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
17541728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20131318 - 20131365
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20131318 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20131365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 20939324 - 20939277
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20939277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22881614 - 22881661
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22881614 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22881661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24483890 - 24483843
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24483890 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24483843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 25705086 - 25705133
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25705086 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25705133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26239159 - 26239112
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26239159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
26239112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31644842 - 31644889
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31644842 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
31644889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 33576116 - 33576069
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33576116 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
33576069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 33732863 - 33732910
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33732863 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33732910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 40302338 - 40302291
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40302338 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
40302291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 41451838 - 41451885
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41451838 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
41451885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 41693675 - 41693722
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41693675 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
41693722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 42695869 - 42695916
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42695869 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42695916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 43788859 - 43788906
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43788859 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43788906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 44559063 - 44559110
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44559063 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
44559110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44985983 - 44985936
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44985983 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
44985936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 353
Target Start/End: Original strand, 45442317 - 45442368
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattc |
353 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
45442317 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttgattttaattc |
45442368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 349
Target Start/End: Original strand, 35155298 - 35155340
Alignment:
| Q |
307 |
aatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggtttta |
35155340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 36815834 - 36815780
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
36815834 |
gctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 44559407 - 44559361
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
44559361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 44985623 - 44985669
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44985669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 343
Target Start/End: Original strand, 10664985 - 10665026
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10664985 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
10665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 17912452 - 17912497
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
17912497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 23990193 - 23990148
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
23990148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 26238816 - 26238861
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
26238861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 27310877 - 27310922
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27310877 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 42358702 - 42358747
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
42358747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 5790559 - 5790615
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
5790559 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
5790615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 17541383 - 17541439
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||| | |||||| |
|
|
| T |
17541383 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
17541439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 349
Target Start/End: Complemental strand, 36806892 - 36806848
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
36806848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 44073806 - 44073750
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
44073806 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
44073750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 146689 - 146642
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
146689 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
146642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2265396 - 2265349
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2265396 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggtttta |
2265349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2481556 - 2481509
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
2481556 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2481509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 3671187 - 3671144
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3671144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3837934 - 3837981
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3837934 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttcgtttta |
3837981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3838263 - 3838216
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
3838216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4042889 - 4042842
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4042889 |
gctaaaatatggtttaggtccctgcaaatatgtctcgttttggtttta |
4042842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4423896 - 4423943
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
4423896 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4423943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4794131 - 4794178
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4794131 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
4794178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5334752 - 5334799
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5334752 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5335039 - 5334992
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5335039 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 8046330 - 8046377
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
8046330 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
8046377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 8046647 - 8046600
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8046647 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
8046600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9195205 - 9195158
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
9195205 |
gctaaaatatggttttagaccctgcaaatatgcctcgttttggtttta |
9195158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10671631 - 10671678
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
10671631 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggtttta |
10671678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 11713844 - 11713797
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11713844 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
11713797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 14003741 - 14003694
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
14003741 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
14003694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 15842822 - 15842775
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
15842822 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 16522992 - 16523039
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
16522992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 16523324 - 16523277
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
16523324 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 16673412 - 16673459
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
16673412 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
16673459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 17302142 - 17302095
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
17302142 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
17302095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 20131680 - 20131633
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
20131680 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20131633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 23989839 - 23989886
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23989839 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
23989886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24358617 - 24358664
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
24358617 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24358664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25705448 - 25705401
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25705448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25705401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 25954116 - 25954163
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25954116 |
gctaaaatatgtttttagtccctgcaaatatgtttcgttttggtttta |
25954163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 27311068 - 27311021
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
27311068 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
27311021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29859871 - 29859824
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
29859871 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29865222 - 29865269
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29865269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31226076 - 31226029
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31226076 |
gctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 33575753 - 33575800
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33575753 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
33575800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 34964158 - 34964111
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
34964158 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagtttta |
34964111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 37228734 - 37228781
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
37228734 |
gctaaaatatggttttggtccctgcaaatatgtatcgttttggtttta |
37228781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 38731830 - 38731877
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38731830 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
38731877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40786461 - 40786508
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
40786461 |
gctaaaatatggttttattcactgcaaatatgtctcgttttggtttta |
40786508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 41694002 - 41693955
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41694002 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
41693955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 43592047 - 43592094
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
43592047 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
43592094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 43597155 - 43597202
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
43597155 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
43597202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 43597498 - 43597451
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43597498 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggtttta |
43597451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44994060 - 44994013
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
44994060 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttagtttta |
44994013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 45442695 - 45442648
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45442695 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggtttta |
45442648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 146328 - 146374
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
146374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 13215364 - 13215318
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
13215364 |
gctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 304 - 389
Target Start/End: Complemental strand, 17912808 - 17912723
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaaa |
389 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctggtaaaaaaaaatttgtttttggtccctgcaaaa |
17912723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 20658408 - 20658362
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20658408 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 31225716 - 31225770
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
31225716 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg |
31225770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 32691314 - 32691368
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
32691314 |
gctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctg |
32691368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 36622582 - 36622536
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
36622536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 37911119 - 37911065
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
37911119 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg |
37911065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 40124967 - 40125021
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
40124967 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 303 - 348
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
1138028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 3832634 - 3832589
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
3832589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 15842464 - 15842509
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 29859490 - 29859535
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 38979890 - 38979947
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatat-gtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| | |||||| |
|
|
| T |
38979890 |
gctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggt |
38979947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 41791311 - 41791266
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41791311 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
41791266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 7814247 - 7814303
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||||||||| | |||||| |
|
|
| T |
7814247 |
gctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
7814303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 304 - 356
Target Start/End: Original strand, 19831511 - 19831563
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
19831563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 32691634 - 32691594
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32691634 |
gctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 43789191 - 43789135
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||| | |||||| |
|
|
| T |
43789191 |
gctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggt |
43789135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1138358 - 1138311
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1138358 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttagtttta |
1138311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1497611 - 1497658
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
1497611 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttgatttta |
1497658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 2481194 - 2481241
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
2481194 |
gctaaaatatggttttggtacttgcaaatatgtctcgttttggtttta |
2481241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3671004 - 3671051
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
3671004 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
3671051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4042611 - 4042658
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4042611 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
4042658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 4794468 - 4794425
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggtttta |
4794425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4842865 - 4842912
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggtttta |
4842912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 7814736 - 7814689
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
7814736 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
7814689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12835326 - 12835373
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
12835326 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
12835373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14003410 - 14003457
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14003410 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
14003457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 16673770 - 16673723
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
16673770 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
16673723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 18113090 - 18113137
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
18113090 |
gctaaaatatggttttggtccctgcaaatatgcctagttttggtttta |
18113137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20658062 - 20658109
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||| |||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
20658062 |
gctaaaacatggttttagtccctgcaaatatgccttgttttggtttta |
20658109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 23732040 - 23732087
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
23732040 |
gctaaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
23732087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24358944 - 24358897
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24358944 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
24358897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24483401 - 24483448
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggtttta |
24483448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 345
Target Start/End: Original strand, 26709697 - 26709740
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
345 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
26709697 |
gctaaaatatgattttagttcctgcaaatatgtctcgttttggt |
26709740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 27109074 - 27109121
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
27109074 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
27109121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29865510 - 29865463
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
29865510 |
gctaaaatatggttttagtccttgcaaatatgcttcgttttggtttta |
29865463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30215423 - 30215470
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30215423 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
30215470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30215870 - 30215823
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
30215870 |
gctaaaatatggttttggtccctgcaaatatatcgcgttttggtttta |
30215823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 34317799 - 34317846
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
34317799 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
34317846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 40301976 - 40302023
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
40301976 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
40302023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 42696202 - 42696155
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
42696155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 1497943 - 1497897
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggtttta |
1497897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 10665293 - 10665239
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
10665293 |
gctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg |
10665239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 18113453 - 18113399
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
18113453 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg |
18113399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 29182440 - 29182394
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
29182394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 41791020 - 41791066
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
41791066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 43671935 - 43671989
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
43671935 |
gctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 44993806 - 44993851
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggtttta |
44993851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 5006610 - 5006655
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggtttta |
5006655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 314 - 351
Target Start/End: Complemental strand, 16900135 - 16900098
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggttttaat |
16900098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 16968555 - 16968600
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggtttta |
16968600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 314 - 351
Target Start/End: Complemental strand, 16993526 - 16993489
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggttttaat |
16993489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 23732327 - 23732282
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
23732327 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 25954423 - 25954378
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgatttta |
25954378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 29831815 - 29831860
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
29831815 |
gctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 348
Target Start/End: Complemental strand, 33576076 - 33576039
Alignment:
| Q |
311 |
tggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggtttt |
33576039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 37229039 - 37228994
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggtttta |
37228994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 43710384 - 43710429
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggtttta |
43710429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 303 - 355
Target Start/End: Complemental strand, 25300038 - 25299987
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagttcct |
25299987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 304 - 356
Target Start/End: Complemental strand, 38732130 - 38732078
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||| || |||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
38732130 |
taaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctg |
38732078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 304 - 347
Target Start/End: Complemental strand, 1696452 - 1696409
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
1696452 |
taaaatatgattttcgtcccttcaaatatgtctcgttttggttt |
1696409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3172021 - 3172068
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
3172021 |
gctaaaatatgattttggtccctgcaaatatgcctcattttggtttta |
3172068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3172531 - 3172484
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
3172531 |
gctaaaatatgattttggtccttgcaaatatgcctcgttttggtttta |
3172484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 306 - 349
Target Start/End: Original strand, 11943543 - 11943586
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
11943543 |
aaatatggttttagtcaatgcgaatatgtctcgttttggtttta |
11943586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 14393127 - 14393081
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
14393127 |
gctaaaatatgattt-agttcctgcaaatatgtctcgttttggtttta |
14393081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26707874 - 26707921
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
26707874 |
gctaaaatatggttttaatccctgcaaatatacttcgttttggtttta |
26707921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31325921 - 31325968
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
31325921 |
gctaaaatatggttctagtccctgcaaatatgcatcgttttagtttta |
31325968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31909477 - 31909431
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
31909477 |
gctaaaatatggttttggtccctgcaaatatgcctc-ttttggtttta |
31909431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 32476096 - 32476143
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
32476096 |
gctaaaatatggttttgatccctgcaaatatgcctcattttggtttta |
32476143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 34318082 - 34318035
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||| ||||| |
|
|
| T |
34318082 |
gctaaaatatggttttggtccctacaaatatgcctcgttttgatttta |
34318035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35155618 - 35155571
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| |||||| ||||| |
|
|
| T |
35155618 |
gctaaaatatggttttggtccctgaaaatatgtcttgttttgatttta |
35155571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 43592379 - 43592332
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||| ||||| ||||| |
|
|
| T |
43592379 |
gctaaaatatgattttagtccctgctaatatgtctcattttgatttta |
43592332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 43672317 - 43672270
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| | |||||||||||| |
|
|
| T |
43672317 |
gctaaaatatgattttggtccctgcaaatatgttttgttttggtttta |
43672270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 43710707 - 43710660
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||| || |||||||||| ||||||||||||||| |
|
|
| T |
43710707 |
gctaaaatatgattttagcccttgcaaatatgcctcgttttggtttta |
43710660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Original strand, 1138055 - 1138089
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggtttt |
1138089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Original strand, 3832344 - 3832378
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
3832344 |
ttttagtccctgcaaatatgtctcattttggtttt |
3832378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 349
Target Start/End: Complemental strand, 22881950 - 22881920
Alignment:
| Q |
319 |
gtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggtttta |
22881920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 1295544 - 1295499
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggtttta |
1295499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 13802487 - 13802536
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||||||||||| | || |||||| ||||||||||||||||| |
|
|
| T |
13802487 |
gctaaaatatggttttagttcttgtaaatattcctcgttttggttttaat |
13802536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 13850881 - 13850836
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggtttta |
13850836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 2e-19; HSPs: 147)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 494751 - 494702
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
494702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 301 - 349
Target Start/End: Original strand, 23770161 - 23770209
Alignment:
| Q |
301 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23770161 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23770209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 23502539 - 23502492
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23502539 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25431853 - 25431806
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25431853 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25431806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30928682 - 30928729
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30928682 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30928729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 19296406 - 19296352
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19296406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
19296352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 26375694 - 26375748
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26375694 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctg |
26375748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 12176640 - 12176595
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12176595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 7156159 - 7156103
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
7156159 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7156103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 15076203 - 15076147
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
15076203 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15076147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 24274130 - 24274074
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
24274130 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
24274074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 31166871 - 31166927
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
31166927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 33801742 - 33801686
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
33801742 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
33801686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 317813 - 317860
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
317813 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
317860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 494406 - 494453
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
494406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
494453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3276353 - 3276306
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3276353 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3276306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3968646 - 3968693
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3968646 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3968693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 6412219 - 6412266
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6412219 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
6412266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 303 - 358
Target Start/End: Complemental strand, 6591440 - 6591385
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| || ||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtttctggt |
6591385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 8170150 - 8170103
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8170150 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8170103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9896636 - 9896589
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9896636 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
9896589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10910963 - 10910916
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10910963 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10910916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 11448538 - 11448585
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11448538 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
11448585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12757611 - 12757658
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12757611 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12757658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 15962388 - 15962341
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15962388 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15962341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 17765010 - 17765057
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17765010 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17765057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19690394 - 19690441
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19690394 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19690441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21385252 - 21385299
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21385252 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
21385299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22543717 - 22543670
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22543717 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
22543670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24692978 - 24692931
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24692978 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgctttta |
24692931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24901240 - 24901287
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24901240 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24901287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 34582530 - 34582577
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34582530 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
34582577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 12299139 - 12299085
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
12299139 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
12299085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 20467717 - 20467663
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
20467717 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 24273829 - 24273883
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
24273829 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 305 - 358
Target Start/End: Original strand, 543365 - 543418
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
543418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 3356495 - 3356450
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3356450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 10091039 - 10091084
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
10091084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 303 - 356
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg |
19320822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 26376042 - 26375997
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26375997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 1890451 - 1890395
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
1890451 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
1890395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 7155798 - 7155854
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
7155798 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7155854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 8680776 - 8680832
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
8680776 |
gctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
8680832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 8681115 - 8681059
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| | |||||| |
|
|
| T |
8681115 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
8681059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 12419937 - 12419881
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
12419937 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
12419881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 14655380 - 14655436
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| | |||||| |
|
|
| T |
14655380 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
14655436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 22822650 - 22822594
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
22822650 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
22822594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 31167199 - 31167143
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
31167199 |
gctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggt |
31167143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 32885674 - 32885730
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
32885674 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
32885730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 318096 - 318049
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
318096 |
gctaaaatatggttttaatccctgcaaatatgtttcgttttggtttta |
318049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1007508 - 1007461
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1007508 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1007461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 2615873 - 2615920
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2615873 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
2615920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3356143 - 3356190
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3356143 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3356190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3414388 - 3414435
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
3414388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3414435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3414751 - 3414704
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
3414751 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
3414704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3969008 - 3968961
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
3969008 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3968961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 303 - 358
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||| | |||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
5286894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12419709 - 12419756
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12419709 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
12419756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14428651 - 14428698
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
14428698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 14656259 - 14656212
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
14656259 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
14656212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15962028 - 15962075
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
15962028 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
15962075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 17771912 - 17771959
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17771912 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
17771959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18024374 - 18024327
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
18024374 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
18024327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19321130 - 19321083
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
19321130 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19321083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21993788 - 21993835
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21993788 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggtttta |
21993835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 21994402 - 21994355
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
21994402 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
21994355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21995065 - 21995112
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
21995065 |
gctaaaatatggttttagtccctgcatatatgcctcgttttggtttta |
21995112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22543355 - 22543402
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
22543355 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22543402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22792898 - 22792851
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
22792898 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
22792851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25137356 - 25137309
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25137356 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25137309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30239294 - 30239341
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30239294 |
gctaaaatatgattttagttcctgcaaatatgtctcgttttggtttta |
30239341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30929043 - 30928996
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30929043 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30928996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31198616 - 31198663
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
31198616 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
31198663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31398540 - 31398493
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31398540 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
31398493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 34582891 - 34582844
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34582891 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
34582844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 2616239 - 2616193
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
2616239 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 6591116 - 6591162
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6591116 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 13617531 - 13617577
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
13617577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 23502238 - 23502284
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
23502238 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 300 - 346
Target Start/End: Original strand, 27764912 - 27764958
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
346 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
27764912 |
atgctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 7324189 - 7324144
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
7324144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 12298825 - 12298870
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgtttta |
12298870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 34990312 - 34990267
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
34990267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 543723 - 543667
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
543723 |
gctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggt |
543667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 778041 - 777985
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| |||||| || ||||| |
|
|
| T |
778041 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtttctggt |
777985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 346
Target Start/End: Original strand, 2373180 - 2373224
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
2373180 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtt |
2373224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 346
Target Start/End: Complemental strand, 11449168 - 11449124
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
346 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
11449168 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtt |
11449124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 23770438 - 23770398
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23770438 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 33808621 - 33808677
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||| ||||| | |||||| |
|
|
| T |
33808621 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
33808677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 388
Target Start/End: Original strand, 777678 - 777764
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggtnnnnnnnnntttgtttttggtccctgcaaa |
388 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
777678 |
gctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaa |
777764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1007125 - 1007172
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1007125 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
1007172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1214995 - 1214948
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
1214995 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggtttta |
1214948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 6412578 - 6412531
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
6412578 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
6412531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 6468311 - 6468358
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
6468311 |
gctaaaatatggttttagtccctgcaaatatgctttgttttggtttta |
6468358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 6564942 - 6564896
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6564942 |
gctaaaat-tggttttggtccctgcaaatatgtctcgttttggtttta |
6564896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10910630 - 10910677
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
10910630 |
gctaaaatatggttttggtctctacaaatatgtctcgttttggtttta |
10910677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 12612358 - 12612311
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||| |||||| |
|
|
| T |
12612358 |
gctaaaatatggtgttagtccctgcaaatatgcctcgttttagtttta |
12612311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13150749 - 13150702
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
13150749 |
gctaaaatatggtattaacccctgcaaatatgtctcgttttggtttta |
13150702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13268110 - 13268157
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
13268110 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttaggtttta |
13268157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19129519 - 19129472
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
19129519 |
gctaaaatatgattttggtccctgcaaatatgtcacgttttggtttta |
19129472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21147405 - 21147452
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21147405 |
gctaaaatatggttttggtccctgcaaatatgcatcgttttggtttta |
21147452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 21385583 - 21385536
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
21385583 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
21385536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 21995424 - 21995377
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
21995424 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggcttta |
21995377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22822308 - 22822355
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
22822308 |
gctaaaatatggttttagtctctgcaaatatacctcgttttggtttta |
22822355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 23628799 - 23628846
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggtttta |
23628846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25121495 - 25121448
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
25121495 |
gctaaaatatggttttggtgcctgcaaatatgtttcgttttggtttta |
25121448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 25136995 - 25137042
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
25136995 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggtttta |
25137042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 346
Target Start/End: Complemental strand, 32885960 - 32885921
Alignment:
| Q |
307 |
aatatggttttagtccctgcaaatatgtctcgttttggtt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32885960 |
aatatggttttagtccctgcaaatatgtctcattttggtt |
32885921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 33131849 - 33131802
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
33131849 |
gctaaaatatggttttagtctttgcaaatatgcctcgttttggtttta |
33131802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 34989962 - 34990009
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgatttta |
34990009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 304 - 358
Target Start/End: Original strand, 1890062 - 1890116
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| ||||| | |||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
1890116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 9896280 - 9896326
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagtttta |
9896326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 11129542 - 11129496
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
11129542 |
gctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 14428948 - 14428902
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggtttta |
14428902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 305 - 343
Target Start/End: Complemental strand, 19690755 - 19690717
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgttttg |
19690717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 354
Target Start/End: Original strand, 15116674 - 15116724
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcc |
354 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
15116674 |
gctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagttcc |
15116724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 20467354 - 20467399
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
20467399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 6564582 - 6564630
Alignment:
| Q |
302 |
gctaaaatatggttttag-tccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||| ||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
6564582 |
gctaaattatggtttttggtccctgcaaatatgtctcgttttggtttta |
6564630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 17765374 - 17765334
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
17765374 |
gctaaaatatgattttggtccctgcaaatatgtctcgtttt |
17765334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 346
Target Start/End: Original strand, 30479064 - 30479108
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
346 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
30479064 |
gctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1214697 - 1214744
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| | ||||||||||| |
|
|
| T |
1214697 |
gctaaaatattgttttggtccctgcaaatatgtcgcattttggtttta |
1214744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 11925740 - 11925787
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
11925740 |
gctaatatatgattttggtccctgcaaatatgtctcgttttgatttta |
11925787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 11926032 - 11925985
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||| ||||||||||||| |
|
|
| T |
11926032 |
gctaaaatatggttttggtctctgaaaatatgtcgcgttttggtttta |
11925985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12176386 - 12176433
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||||||| |||||| |
|
|
| T |
12176386 |
gctaaaatatggttttagcccatgtaaatatgtctcgttttagtttta |
12176433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14655904 - 14655951
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||| |||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
14655904 |
gctaaaacatggttttggtccctgcaaatatatttcgttttggtttta |
14655951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 333
Target Start/End: Complemental strand, 15117039 - 15117008
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15117039 |
gctaaaatatggttttagtccctgcaaatatg |
15117008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15442938 - 15442985
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
15442938 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgatttta |
15442985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 15722611 - 15722658
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
15722611 |
gctaaaatatggttttggtctatgcaaatatgtctcgttttgatttta |
15722658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19129337 - 19129384
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
19129337 |
gctacaatatggctttggtccctgcaaatatgcctcgttttggtttta |
19129384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19267566 - 19267613
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
19267566 |
gctaaaatatggttttggtccctgtaaatatgcttcgttttggtttta |
19267613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 314 - 349
Target Start/End: Complemental strand, 19275223 - 19275188
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggtttta |
19275188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19296109 - 19296156
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
19296109 |
gctaaaacatggttttagtccctgcaaatatgcgtcgttttgatttta |
19296156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 25121185 - 25121231
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
25121185 |
gctaaaatatggttttcatcc-tgcaaatatgtctcgttttggtttta |
25121231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30479421 - 30479374
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || | |||||||||| ||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
30479374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31186590 - 31186543
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||||| |||||| |
|
|
| T |
31186590 |
gctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgtttta |
31186543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31276339 - 31276292
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgatttta |
31276292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Original strand, 13268182 - 13268216
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggtttt |
13268216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 19129447 - 19129413
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggtttt |
19129413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 25431577 - 25431631
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||| |||||||| ||||| |||||| |
|
|
| T |
25431577 |
gctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctg |
25431631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 27765101 - 27765067
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
27765101 |
ttttggtccctgcaaatatgtctcgttttggtttt |
27765067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 12757935 - 12757886
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||| ||| |||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
12757935 |
gctaaaacatgattttggtccctgcaaatatgtatccttttggttttaat |
12757886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 18024014 - 18024059
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggtttta |
18024059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 354
Target Start/End: Original strand, 12611996 - 12612048
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcc |
354 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | ||||| |||||| |||| |
|
|
| T |
12611996 |
gctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcc |
12612048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 13268459 - 13268419
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
13268459 |
gctaaaataaggttttggtccctgcaaatatgtctggtttt |
13268419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 349
Target Start/End: Complemental strand, 13617804 - 13617768
Alignment:
| Q |
313 |
gttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggtttta |
13617768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 305 - 349
Target Start/End: Original strand, 19275044 - 19275088
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| | ||||| |||||| |||||||||||||| |
|
|
| T |
19275044 |
aaaatatggttttaggctctgcagatatgtttcgttttggtttta |
19275088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 304 - 340
Target Start/End: Complemental strand, 27765173 - 27765137
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgtt |
340 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27765173 |
taaaatatggttttggtccctgcaaatatatctcgtt |
27765137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 2e-19; HSPs: 205)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 303 - 356
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 9289267 - 9289323
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
9289267 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 50714564 - 50714508
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
50714564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
50714508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13479610 - 13479563
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479610 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22099911 - 22099864
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22099911 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22099864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24474962 - 24474915
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24474962 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
24474915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29380909 - 29380862
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29380909 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29380862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 34361804 - 34361851
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34361804 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
34361851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46088059 - 46088012
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46088059 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
46088012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 32365095 - 32365149
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
32365095 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
32365149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 45505893 - 45505839
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
45505893 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
45505839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 45593585 - 45593531
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
45593585 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg |
45593531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 53916046 - 53915992
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53916046 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 306 - 358
Target Start/End: Complemental strand, 9289634 - 9289582
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
9289634 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 23778965 - 23779021
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
23778965 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcttggt |
23779021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 35415632 - 35415576
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
35415632 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35415576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 35763648 - 35763704
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
35763648 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35763704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 41345854 - 41345910
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
41345854 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41345910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 304 - 356
Target Start/End: Complemental strand, 55072709 - 55072657
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
55072657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13064464 - 13064417
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13064464 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13064417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13073760 - 13073807
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13073760 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13073807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13631229 - 13631276
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13631229 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13631276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 14791805 - 14791758
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14791805 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
14791758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 15555637 - 15555590
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
15555590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 16712690 - 16712643
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16712690 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16712643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 18205157 - 18205204
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18205157 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18205204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22099544 - 22099591
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22099544 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22099591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 22584288 - 22584335
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22584288 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
22584335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 25423925 - 25423972
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25423925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25423972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25424311 - 25424264
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25424311 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25424264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29420536 - 29420489
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29420536 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
29420489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 357
Target Start/End: Original strand, 29463611 - 29463666
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctgg |
357 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29463611 |
gctaaaatatggttttatttcctgcaaatatgcctcgttttggttttaattcctgg |
29463666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 32208543 - 32208590
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32208543 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32208590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 32365482 - 32365435
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32365482 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
32365435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35464019 - 35464066
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35464019 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35464066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 36702001 - 36702048
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36702001 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
36702048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 41346217 - 41346170
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41346217 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
41346170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 43231089 - 43231136
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43231089 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
43231136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46115778 - 46115731
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46115778 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggtttta |
46115731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46128912 - 46128865
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46128912 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggtttta |
46128865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 51708694 - 51708741
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51708694 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
51708741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 52017506 - 52017553
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52017506 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 52017869 - 52017822
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52017869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 52430099 - 52430052
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52430099 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
52430052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 52441764 - 52441811
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52441764 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
52441811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 52442091 - 52442044
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52442091 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
52442044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 53716922 - 53716969
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53716922 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
53716969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 53717173 - 53717126
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53717173 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
53717126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 12152492 - 12152446
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12152492 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
12152446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 304 - 358
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15555560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 19903653 - 19903607
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19903607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 29380669 - 29380715
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29380669 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 29463912 - 29463866
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29463912 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 304 - 358
Target Start/End: Original strand, 41619902 - 41619956
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41619956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 43368467 - 43368513
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
43368513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 11285502 - 11285551
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11285502 |
atgctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
11285551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 13764614 - 13764659
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13764614 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13764659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 38054549 - 38054594
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
38054594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 51545966 - 51545921
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
51545921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 54208822 - 54208777
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
54208777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 123535 - 123591
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| | |||||| |
|
|
| T |
123535 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
123591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 304 - 356
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 6827873 - 6827817
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
6827873 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6827817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 50714241 - 50714297
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| | |||||| |
|
|
| T |
50714241 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
50714297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2034854 - 2034807
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
2034854 |
gctaaaatatggttttagtcccagcaaatatgcctcgttttggtttta |
2034807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 2180221 - 2180268
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
2180221 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
2180268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2322431 - 2322384
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2322431 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
2322384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4279023 - 4279070
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
4279023 |
gctaaaatatggttttagcccctgcaaatatatctcgttttggtttta |
4279070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4279334 - 4279287
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4279334 |
gctaaaatatgattttagtccctgcaaatatggctcgttttggtttta |
4279287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5052583 - 5052536
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5052583 |
gctacaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5052536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5827656 - 5827703
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
5827656 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
5827703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5827972 - 5827925
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5827972 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
5827925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 6827547 - 6827594
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
6827547 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6827594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 8760605 - 8760652
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8760605 |
gctaaaatatagttttactccctgcaaatatgtctcgttttggtttta |
8760652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 8760780 - 8760733
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
8760780 |
gctaaaatatggttttagtccttgcaaatatggctcgttttggtttta |
8760733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 11693120 - 11693073
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
11693120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
11693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13064160 - 13064207
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13064160 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
13064207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13530712 - 13530665
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13530712 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
13530665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13631598 - 13631551
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13631598 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
13631551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 14488186 - 14488139
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
14488186 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14488139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19321858 - 19321811
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
19321858 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
19321811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 23245232 - 23245279
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
23245232 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23245279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 23245594 - 23245547
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23245594 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
23245547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 23779224 - 23779177
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
23779224 |
gctaaaatatggttttaatccctgcaaatatgtctcattttggtttta |
23779177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24774046 - 24774093
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
24774046 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24774093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26412191 - 26412238
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26412191 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
26412238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26412583 - 26412536
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
26412583 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
26412536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 27008085 - 27008132
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27008085 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
27008132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28809012 - 28809059
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
28809012 |
gctaaaatatggttttagtccttgcaaatatgtatcgttttggtttta |
28809059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28809179 - 28809132
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28809179 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
28809132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29499183 - 29499230
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
29499183 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30046791 - 30046744
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
30046791 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30046744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30061132 - 30061085
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
30061132 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30061085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31560694 - 31560647
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
31560694 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
31560647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31812212 - 31812165
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
31812212 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
31812165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35464381 - 35464334
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35464381 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35464334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 36050289 - 36050336
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
36050336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 41921083 - 41921036
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
41921083 |
gctaaaatatggttttagcccctgcaaatatgtttcgttttggtttta |
41921036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 42823777 - 42823824
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42823777 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
42823824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 42848028 - 42848075
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
42848028 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
42848075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 42848390 - 42848343
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
42848390 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
42848343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 43231388 - 43231341
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
43231388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
43231341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 44925486 - 44925533
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44925486 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
44925533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 45505601 - 45505648
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
45505601 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
45505648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 46115415 - 46115462
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
46115415 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46115462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 46128549 - 46128596
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
46128549 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46128596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46292650 - 46292603
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
46292650 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
46292603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 47136170 - 47136123
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
47136123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 47274229 - 47274182
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47274229 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
47274182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 51545630 - 51545677
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51545630 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
51545677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 51709026 - 51708979
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
51709026 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
51708979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 51738138 - 51738185
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
51738138 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 52543423 - 52543470
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
52543423 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 53308067 - 53308020
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
53308067 |
gctaaaatatggttttggtccctgcaaatatgtcccgttttggtttta |
53308020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 55072390 - 55072437
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55072390 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
55072437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 4211562 - 4211608
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4211562 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 9445951 - 9445997
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
9445997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 9446322 - 9446276
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
9446322 |
gctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 14487803 - 14487849
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14487803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
14487849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 18831176 - 18831130
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggtttta |
18831130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 30564835 - 30564881
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggtttta |
30564881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 46292393 - 46292439
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
46292393 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 306 - 356
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg |
47532617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 7639897 - 7639946
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttaat |
7639946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 8191390 - 8191345
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
8191390 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
8191345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 28449213 - 28449164
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
28449213 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaat |
28449164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 29499543 - 29499498
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 31182503 - 31182458
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
31182503 |
gctaaaatatggttttaattcctgcaaatatgtctcgttttggttt |
31182458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 35119610 - 35119565
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
35119610 |
gctaaaatatggttttggtcactgcaaatatgtctcgttttggttt |
35119565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 47022743 - 47022788
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
47022788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 35415300 - 35415356
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||| | |||||| |
|
|
| T |
35415300 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
35415356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 35763954 - 35763898
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||||||||||||||| | |||||| |
|
|
| T |
35763954 |
gctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggt |
35763898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 41620255 - 41620199
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||| | |||||| |
|
|
| T |
41620255 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
41620199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 304 - 356
Target Start/End: Original strand, 50753925 - 50753977
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg |
50753977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 300 - 356
Target Start/End: Complemental strand, 51763203 - 51763147
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
51763203 |
atgctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 123893 - 123850
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggtttta |
123850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2180571 - 2180524
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
2180571 |
gctaaaatatagttttagtccctgcaaatatggcacgttttggtttta |
2180524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 2322094 - 2322141
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
2322141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5882553 - 5882599
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
5882553 |
gctaaaatatggttttagtcc-tgcaaatatgcctcgttttggtttta |
5882599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 6353637 - 6353590
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
6353590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 8904887 - 8904934
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
8904887 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 12791973 - 12791926
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
12791973 |
gctaaaatatgatttttgtccctgcaaatatgcctcgttttggtttta |
12791926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13074124 - 13074077
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13074124 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
13074077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13530380 - 13530427
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
13530380 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
13530427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 13764806 - 13764759
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
13764806 |
gctaaaatatggttttggtccctgtaaatatgtttcgttttggtttta |
13764759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14594207 - 14594254
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
14594207 |
gctaaaatatggttttggtccctgcaaatatgtctcactttggtttta |
14594254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20291987 - 20292034
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
20291987 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
20292034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 346
Target Start/End: Complemental strand, 25358499 - 25358464
Alignment:
| Q |
311 |
tggttttagtccctgcaaatatgtctcgttttggtt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggtt |
25358464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25358539 - 25358492
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
25358539 |
gctaaaatatgattttggtccctgtaaatatgtctcgttttggtttta |
25358492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26314331 - 26314284
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
26314331 |
gctaaaatatggttttgatccctgaaaatatgtctcgttttggtttta |
26314284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 27008401 - 27008358
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggtttta |
27008358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 27427873 - 27427919
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
27427873 |
gctaaaatatggttt-agtccctgcaaatatggctcgttttggtttta |
27427919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28448835 - 28448882
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
28448835 |
gctaaaatatggttttagtccttacaaatatgcctcgttttggtttta |
28448882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31811926 - 31811973
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31811926 |
gctaaaatatggttttgatccctgcaaatatgtatcgttttggtttta |
31811973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 32208900 - 32208853
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
32208900 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttgatttta |
32208853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 34355282 - 34355235
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
34355282 |
gctaaaatatggttttagtccctcaaaatatgactcgttttggtttta |
34355235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 36702362 - 36702315
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggtttta |
36702315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 42824090 - 42824043
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
42824090 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttgatttta |
42824043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 45474595 - 45474548
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
45474595 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggtttta |
45474548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 47023104 - 47023057
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
47023104 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggtttta |
47023057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 53915684 - 53915731
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
53915684 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
53915731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 54903474 - 54903427
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
54903474 |
gctaaaatatggttttggtccctgcaaatatgccccgttttggtttta |
54903427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 55482467 - 55482420
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
55482467 |
gctaaaatatgattttagtccctccaaatatgcctcgttttggtttta |
55482420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 345
Target Start/End: Original strand, 16712331 - 16712373
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
345 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
16712373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 35420701 - 35420655
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggtttta |
35420655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 304 - 358
Target Start/End: Original strand, 41920771 - 41920825
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| ||||| || ||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgattttagtttctggt |
41920825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 43368776 - 43368722
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||| | || |||||||||| |||||||||||||| |||||| |
|
|
| T |
43368776 |
gctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctg |
43368722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 51830891 - 51830937
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggtttta |
51830937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 5797484 - 5797529
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggtttta |
5797529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 14791502 - 14791547
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
14791547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 20144423 - 20144468
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
20144468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 30060772 - 30060817
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgttttta |
30060817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Complemental strand, 44925846 - 44925797
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||| ||||||||||||||| |
|
|
| T |
44925846 |
atgctaaaatatggttttggtctccgcaaatatgcctcgttttggtttta |
44925797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 350
Target Start/End: Complemental strand, 20144730 - 20144682
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaa |
350 |
Q |
| |
|
|||||||||||||||| || | |||||||||| |||||||||||||||| |
|
|
| T |
20144730 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaa |
20144682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 306 - 349
Target Start/End: Original strand, 2034544 - 2034587
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggtttta |
2034587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 341
Target Start/End: Original strand, 12152155 - 12152194
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttt |
341 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
12152155 |
gctaaaatatggttttggtccctgcaaatatgactcgttt |
12152194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 305 - 356
Target Start/End: Complemental strand, 14594561 - 14594510
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||| |||||||||||| |||||| |
|
|
| T |
14594561 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctg |
14594510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22584606 - 22584559
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
22584606 |
gctaaaatgtggttttagtctctgcaaatatgcttcgttttggtttta |
22584559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24474601 - 24474647
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
24474601 |
gctaaaatatggttttagt-cctgcaaatatgcatcgttttggtttta |
24474647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26313989 - 26314036
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
26313989 |
gctaaaatatggttttgatccctgcaaatatgttccgttttggtttta |
26314036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31370805 - 31370852
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
31370805 |
gctaaaatatggttttagtgtctgcgaatatgcctcgttttggtttta |
31370852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31560332 - 31560379
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
31560332 |
gctaaaatatggttttgatccctgcaaatatgcttcgttttggtttta |
31560379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35119293 - 35119340
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
35119293 |
gctaaaatatggttttggtccctgcaaatatgctccgttttggtttta |
35119340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 36054149 - 36054102
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
36054149 |
gctaaaatacggttttggtccctgcaaatatgcctcattttggtttta |
36054102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 37557194 - 37557147
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgatttta |
37557147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 41324889 - 41324842
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
41324889 |
gctaaaatatggttttgatctctgcaaatatgcctcgttttggtttta |
41324842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 45593229 - 45593276
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
45593229 |
gctaaaatatagttttagtccctacaaatatgcctcgttttggcttta |
45593276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 2322359 - 2322325
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
2322359 |
ttttggtccctgcaaatatgtctcgttttggtttt |
2322325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 304 - 342
Target Start/End: Original strand, 5202929 - 5202967
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
5202967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 8905162 - 8905128
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
8905162 |
ttttggtccctgcaaatatgtctcgttttggtttt |
8905128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 300 - 334
Target Start/End: Original strand, 12791608 - 12791642
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgt |
334 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
12791608 |
atgctaaaatatagttttagtccctgcaaatatgt |
12791642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 14594494 - 14594460
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggtttt |
14594460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Original strand, 20144492 - 20144526
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
20144492 |
ttttggtccctgcaaatatgtctcgttttggtttt |
20144526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 51738410 - 51738364
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |||| |
|
|
| T |
51738410 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttgatttt |
51738364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 54903403 - 54903369
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
54903403 |
ttttggtccctgcaaatatgtctcgttttggtttt |
54903369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 8905233 - 8905184
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||| ||||| ||||||| |
|
|
| T |
8905233 |
gctaaaatatggttttggtccctgtaaatatgcctcattttgattttaat |
8905184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 28197278 - 28197233
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||| || |||||| |
|
|
| T |
28197278 |
taaaatatggttttagtctctacaaatatgtctcgtctttgtttta |
28197233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 41439790 - 41439835
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| | ||| |||||| |||||||||||||||| |
|
|
| T |
41439790 |
taaaatatggttttagcctctgtaaatatttctcgttttggtttta |
41439835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 348
Target Start/End: Original strand, 43231189 - 43231226
Alignment:
| Q |
311 |
tggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
43231189 |
tggttttggtccctgcaaatatgtctcattttggtttt |
43231226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 50822013 - 50822058
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggtttta |
50822058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 348
Target Start/End: Original strand, 53307832 - 53307861
Alignment:
| Q |
319 |
gtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53307832 |
gtccctgcaaatatgtctcgttttggtttt |
53307861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 304 - 332
Target Start/End: Complemental strand, 51831002 - 51830974
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatat |
332 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51831002 |
taaaatatggttttagtccctgcaaatat |
51830974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 303 - 351
Target Start/End: Complemental strand, 52543725 - 52543677
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||| |||| || | |||||||||| ||||||||||||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggttttaat |
52543677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 304 - 356
Target Start/End: Original strand, 54903114 - 54903166
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
54903114 |
taaaatatggttttgatccctacaaatatgcatcgttttagttttaattcctg |
54903166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 1312 - 1368
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
1312 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
1368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 1643 - 1587
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
1643 |
gctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 288 - 232
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
288 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12526 - 12573
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12526 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 48; Significance: 3e-18; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 4042 - 4089
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4042 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19224 - 19271
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19224 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4287 - 4240
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4287 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
4240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19469 - 19422
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19469 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
19422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3533 - 3580
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3533 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
3580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3917 - 3870
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3917 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 3e-18; HSPs: 183)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 13769775 - 13769822
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13769775 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13769822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19561449 - 19561402
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19561449 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19561402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35210514 - 35210467
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210514 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
35210467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 39832907 - 39832954
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39832907 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39832954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44344788 - 44344741
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344788 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
44344741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 48359074 - 48359027
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48359074 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48359027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 8555798 - 8555744
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8555798 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
8555744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 302 - 355
Target Start/End: Original strand, 18022368 - 18022421
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcct |
18022421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 43300611 - 43300660
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43300611 |
atgctaaaatatggttttagttcctgcaaatatgtctcgttttggtttta |
43300660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 1006836 - 1006892
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
1006836 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1006892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 6108335 - 6108391
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
6108335 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6108391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 349
Target Start/End: Original strand, 37372441 - 37372485
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
37372485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 44508721 - 44508777
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
44508721 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 44509053 - 44508997
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
44509053 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1614560 - 1614607
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1614560 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1614607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 1974010 - 1974057
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1974010 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
1974057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 7431952 - 7431999
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7431952 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7431999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 8144296 - 8144343
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8144296 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8144343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 12894401 - 12894354
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12894401 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
12894354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 17999720 - 17999673
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17999720 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
17999673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19561155 - 19561202
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19561155 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19561202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19757749 - 19757796
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19757749 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19757796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19783816 - 19783863
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19783816 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
19783863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 23399975 - 23399928
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23399975 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
23399928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 23816671 - 23816718
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23816671 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
23816718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 25092161 - 25092208
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25092161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25092208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25547489 - 25547442
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25547489 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
25547442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 25988386 - 25988433
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25988386 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25988433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 27458400 - 27458447
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27458400 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
27458447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 28911905 - 28911858
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28911905 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28911858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30709643 - 30709596
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30709643 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
30709596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35837925 - 35837972
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35837925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35837972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35838336 - 35838289
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35838336 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35838289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 37372903 - 37372856
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37372903 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37372856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44403248 - 44403201
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44403248 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
44403201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 46759659 - 46759706
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46759659 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
46759706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 13770080 - 13770026
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
13770080 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg |
13770026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 17854151 - 17854197
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
17854197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 17999466 - 17999512
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17999466 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 31732102 - 31732156
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
31732102 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctg |
31732156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 45073315 - 45073369
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
45073315 |
gctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctg |
45073369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 23676135 - 23676180
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
23676180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 31503780 - 31503735
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
31503735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 34878124 - 34878075
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34878124 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaat |
34878075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 46648714 - 46648665
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
46648714 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaat |
46648665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 35015219 - 35015163
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
35015219 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
35015163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 45021855 - 45021799
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| ||| |||| |
|
|
| T |
45021855 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttcatggt |
45021799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 304 - 356
Target Start/End: Original strand, 45671217 - 45671269
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctg |
45671269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1614903 - 1614856
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1614903 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1614856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 3975550 - 3975597
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
3975550 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3975837 - 3975790
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
3975837 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5234203 - 5234156
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
5234203 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5234156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5308324 - 5308371
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
5308324 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
5308371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 6079810 - 6079857
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
6079857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 6509209 - 6509256
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
6509209 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttcgtttta |
6509256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 6509469 - 6509422
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
6509469 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
6509422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 8144657 - 8144610
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
8144657 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8144610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9659688 - 9659641
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
9659688 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9659641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 10358367 - 10358320
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
10358367 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
10358320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14543711 - 14543758
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
14543711 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14543758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 16853588 - 16853541
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
16853588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16853541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18022703 - 18022656
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18022703 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
18022656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 20388275 - 20388322
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
20388275 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
20388322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 21223747 - 21223700
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21223747 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
21223700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 23399613 - 23399660
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
23399613 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23399660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 23676451 - 23676404
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
23676451 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23676404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25988748 - 25988701
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25988748 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25988701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 26878070 - 26878023
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
26878070 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
26878023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28911578 - 28911625
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
28911578 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
28911625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 29198304 - 29198351
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
29198304 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggtttta |
29198351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 29198661 - 29198614
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
29198661 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29198614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 30223462 - 30223509
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
30223462 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
30223509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 304 - 347
Target Start/End: Original strand, 30352563 - 30352606
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
30352606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 31310366 - 31310413
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31310366 |
gctaaaatatgattttagtccctgcaaatatttctcgttttggtttta |
31310413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 39439028 - 39438981
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
39439028 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
39438981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 39719641 - 39719594
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
39719641 |
gctaaaatatggttttagtccctgcaaatatggctcgttttagtttta |
39719594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 39833235 - 39833188
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
39833235 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
39833188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44568689 - 44568642
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44568689 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
44568642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 45073640 - 45073593
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45073640 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45073593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 45228917 - 45228870
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
45228917 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45228870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46304383 - 46304336
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46304383 |
gctaaaatatagttttagtccctgcaaatatgtttcgttttggtttta |
46304336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46759941 - 46759894
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46759941 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
46759894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 46828945 - 46828992
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
46828945 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
46828992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 48192487 - 48192440
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
48192487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 1559344 - 1559398
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
1559344 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctg |
1559398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 3807865 - 3807919
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||||||||||||||| |||||| |
|
|
| T |
3807865 |
gctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Original strand, 6589022 - 6589068
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
6589022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 304 - 342
Target Start/End: Complemental strand, 18891562 - 18891524
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
18891524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 23817033 - 23816979
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
23817033 |
gctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg |
23816979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 28262714 - 28262768
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
28262714 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg |
28262768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 32189388 - 32189342
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
32189342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 344
Target Start/End: Original strand, 45021495 - 45021537
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgg |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45021495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
45021537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 25547256 - 25547301
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
25547301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 31310678 - 31310633
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31310678 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 32189077 - 32189126
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32189077 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttaat |
32189126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 34877777 - 34877822
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
34877822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 37953048 - 37953003
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggtttta |
37953003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 44344458 - 44344507
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
44344458 |
gctaaaatatggttttagttcccgcaaatatgtctcgtttcggttttaat |
44344507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 48192260 - 48192305
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 347
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
307 |
aatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 342
Target Start/End: Complemental strand, 1559704 - 1559664
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1559704 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttt |
1559664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 305 - 349
Target Start/End: Original strand, 6954862 - 6954906
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggtttta |
6954906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 304 - 348
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 14739003 - 14738947
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||| | |||||| |
|
|
| T |
14739003 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
14738947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 304 - 348
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 30352903 - 30352847
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
30352903 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
30352847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 301 - 349
Target Start/End: Complemental strand, 37527422 - 37527374
Alignment:
| Q |
301 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
37527422 |
tgctaaaatatggttttggtccctccaaatatgtcttgttttggtttta |
37527374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 489071 - 489024
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
489071 |
gctaaaatatgattttagtctctgcaaatatgtctcgttttgatttta |
489024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 1007228 - 1007181
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
1007228 |
gctaaaatatggttttagtccctccaaatatgcctcgttttgatttta |
1007181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5233809 - 5233856
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5233809 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
5233856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5354769 - 5354816
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
5354769 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
5354816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 9659356 - 9659403
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
9659356 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
9659403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10358002 - 10358049
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
10358002 |
gctaaaatatgatcttagtccctgcaaatatgcctcgttttggtttta |
10358049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18927090 - 18927043
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
18927090 |
gctaaaatatagttttagtccctgcaaatatgtctcattttagtttta |
18927043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 19465979 - 19465933
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
19465979 |
gctaaaatatggttttag-ccctgcaaatatgtctcgtttcggtttta |
19465933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21223406 - 21223453
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
21223406 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
21223453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 21554394 - 21554441
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
21554394 |
gctaaaatatgattttagtccctgaaaatatgcctcgttttggtttta |
21554441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 21554752 - 21554705
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
21554752 |
gctaaaatatggttttagtccctgcaaatatgccttgttttgatttta |
21554705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 24717531 - 24717484
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
24717531 |
gctaaaatatggttttggtccctaccaatatgtctcgttttggtttta |
24717484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 25092547 - 25092500
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
25092547 |
gctaaaatatggttttggtccctgcaaatatgcctctttttggtttta |
25092500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 26877679 - 26877726
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
26877679 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggtttta |
26877726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 27037594 - 27037641
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
27037594 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
27037641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 30223794 - 30223747
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
30223794 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttggtttta |
30223747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 31732450 - 31732403
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
31732450 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
31732403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35104079 - 35104126
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35104079 |
gctaaaatataattttggtccctgcaaatatgtctcgttttggtttta |
35104126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 35104290 - 35104247
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35104290 |
aaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35104247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35469881 - 35469928
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35469881 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggtttta |
35469928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 35665878 - 35665925
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
35665878 |
gctaaaatatggttttaatccctacaaatatgcctcgttttggtttta |
35665925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 39438742 - 39438789
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
39438742 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
39438789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 39520399 - 39520446
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
39520399 |
gctaaaatatggttttggtccatccaaatatgtctcgttttggtttta |
39520446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 39719354 - 39719401
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
39719354 |
gctaaaatatggttttagtccctacaaatatgcctcattttggtttta |
39719401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 41054235 - 41054188
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
41054235 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
41054188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 41364885 - 41364932
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
41364885 |
gctaaaatatggttttaatctctacaaatatgtctcgttttggtttta |
41364932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 41365213 - 41365166
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggtttta |
41365166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 44402961 - 44403008
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | | ||||||||||| |
|
|
| T |
44402961 |
gctaaaatatggttttagtccctgcaaatatgccccattttggtttta |
44403008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 44568327 - 44568374
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
44568327 |
gctaaaatatggttttggtccctgcaaatataactcgttttggtttta |
44568374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 44958505 - 44958458
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
44958505 |
gctaaaatatgattttggtccctacaaatatgtctcgttttggtttta |
44958458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 46304087 - 46304134
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
46304087 |
gctaaaatatgattttagttcctgcaaatatgcctcgttttggtttta |
46304134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 46829311 - 46829264
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
46829311 |
gctaaaatatggttttgatccctgcaaatatgtctcattttggtttta |
46829264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 48852445 - 48852492
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
48852445 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
48852492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 6847117 - 6847071
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
6847071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 20388674 - 20388620
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||| ||||| |||||| |
|
|
| T |
20388674 |
gctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctg |
20388620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 37952671 - 37952717
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggtttta |
37952717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 43058752 - 43058798
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgatttta |
43058798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 5355114 - 5355069
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggtttta |
5355069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 6589271 - 6589226
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggtttta |
6589226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 16941049 - 16941004
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16941004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 30709328 - 30709373
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggtttta |
30709373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 38186369 - 38186414
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
38186414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 355
Target Start/End: Original strand, 38486479 - 38486532
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||||||||| |||||| ||||| |
|
|
| T |
38486479 |
gctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcct |
38486532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 39520727 - 39520682
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
39520682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 45671545 - 45671500
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagtttta |
45671500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 316 - 356
Target Start/End: Original strand, 12894056 - 12894096
Alignment:
| Q |
316 |
ttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccctg |
12894096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 38186760 - 38186712
Alignment:
| Q |
302 |
gctaaaatatggttttag-tccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
38186760 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggtttta |
38186712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 310 - 349
Target Start/End: Complemental strand, 1271590 - 1271551
Alignment:
| Q |
310 |
atggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggtttta |
1271551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2945844 - 2945797
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
2945844 |
gctaaaatatgtttttggtccctacaaatatgcctcgttttggtttta |
2945797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 314 - 349
Target Start/End: Complemental strand, 3808106 - 3808071
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggtttta |
3808071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 5308685 - 5308639
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5308685 |
gctaaaatatg-ttttagtccctgcaaatatacctcgttttggtttta |
5308639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 6892259 - 6892212
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||||| |||| |
|
|
| T |
6892259 |
gctaaaatatggttttggtccctgcaaaaatgtcttgttttgggttta |
6892212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 6911246 - 6911199
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
6911246 |
gctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 353
Target Start/End: Original strand, 8555608 - 8555659
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattc |
353 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
8555608 |
gctaaaatatagttttagtttctgcaaatatgacttgttttggttttaattc |
8555659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 11767274 - 11767227
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
11767274 |
gctaaaatatggttttggtccctgcaaatatgcttcattttggtttta |
11767227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 12932782 - 12932735
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
12932782 |
gctaaaatatgtttttggtccctgcaaatatgcctcgttttgatttta |
12932735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 16940763 - 16940810
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
16940763 |
gctaacatatggttttggtccctgcaaatatgcctcggtttggtttta |
16940810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 19005599 - 19005646
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
19005599 |
gctaaaatatagttttggtccctgtaaatatgtctcgttttgatttta |
19005646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 28528906 - 28528953
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| || |||| ||||||||||||||| ||||||| |
|
|
| T |
28528906 |
gctaaaatatggttttggttcctgtaaatatgtctcgtttgggtttta |
28528953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 41053843 - 41053890
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||| ||||| |
|
|
| T |
41053843 |
gctaaaatatggttttggtccctgcaaatatgcctcattttgatttta |
41053890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 48854069 - 48854022
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
48854069 |
gctaaaatatgattttgatccctgcaaatatgtttcgttttggtttta |
48854022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 1271526 - 1271492
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1271526 |
ttttagtccctgcaaatatgtctcgttttagtttt |
1271492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Complemental strand, 19005865 - 19005831
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggtttt |
19005831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 303 - 349
Target Start/End: Complemental strand, 20355768 - 20355722
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||| |||||| |
|
|
| T |
20355768 |
ctaaaatatggttttagtccccgtaaatatgtttcgttttagtttta |
20355722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 22539931 - 22539985
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||| ||||||||||| |||||| |
|
|
| T |
22539931 |
gctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg |
22539985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Original strand, 44841428 - 44841462
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44841428 |
ttttggtccctgcaaatatgtctcgttttggtttt |
44841462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 304 - 342
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
342 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 7432249 - 7432204
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||| ||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgatttta |
7432204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 14738603 - 14738648
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggtttta |
14738648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 24954147 - 24954102
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
24954147 |
taaaatatggtcttagaccctgcaaatatgattcgttttggtttta |
24954102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 31503423 - 31503468
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||| ||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggtttta |
31503468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 355
Target Start/End: Original strand, 36684536 - 36684589
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
36684536 |
gctaaaatatggctttgatccatgcaaatatatctcgttttggttttaactcct |
36684589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 44841359 - 44841404
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
44841404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 303 - 347
Target Start/End: Original strand, 18926889 - 18926933
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||||| | | |||||||| ||||||||||||| |
|
|
| T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggttt |
18926933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 309 - 349
Target Start/End: Original strand, 24953828 - 24953868
Alignment:
| Q |
309 |
tatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggtttta |
24953868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 302 - 356
Target Start/End: Complemental strand, 10514 - 10460
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
10514 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
10460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 10169 - 10216
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
10169 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
10216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 5707 - 5651
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| | |||||| |
|
|
| T |
5707 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
5651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5400 - 5447
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
5400 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
5447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 94331 - 94279
Alignment:
| Q |
300 |
atgctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatt |
352 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
94331 |
atgctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatt |
94279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 94058 - 94112
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
94058 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctg |
94112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 2779 - 2826
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2779 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5210 - 5257
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5210 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 5230 - 5277
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5230 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 9027 - 8980
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9027 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 303 - 349
Target Start/End: Original strand, 8734 - 8780
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 14698 - 14745
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14698 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 15011 - 14964
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15011 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
14964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3290 - 3243
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3290 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
3243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24373 - 24420
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24373 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggtttta |
24420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 27363 - 27316
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27363 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
27316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 306 - 343
Target Start/End: Original strand, 27005 - 27042
Alignment:
| Q |
306 |
aaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
27005 |
aaatttggttttggtccctgcaaatatgtctcgttttg |
27042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 8331 - 8378
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8331 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
8378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 8641 - 8594
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8641 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
8594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 44; Significance: 7e-16; HSPs: 5)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 47926 - 47973
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47926 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
47973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 223171 - 223124
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
223171 |
gctaaaatatggttttggtccctgcaaatatgtctcactttggtttta |
223124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 48228 - 48183
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
48183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 305 - 356
Target Start/End: Original strand, 222817 - 222868
Alignment:
| Q |
305 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||| |||||||||||| |||||| |
|
|
| T |
222817 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctg |
222868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Original strand, 222884 - 222918
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
222884 |
ttttggtccctgcaaatatgtctcgttttggtttt |
222918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 366272 - 366225
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
366272 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
366225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 365980 - 366027
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
365980 |
gctaaaatatggttttaatccttgcaaatatgcctcgttttggtttta |
366027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 148281 - 148234
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
148281 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
148234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 4311 - 4266
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4311 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 349
Target Start/End: Original strand, 4016 - 4057
Alignment:
| Q |
308 |
atatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggtttta |
4057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 50075 - 50030
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
50030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 55176 - 55131
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
55131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 54816 - 54863
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
54816 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
54863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 8548 - 8604
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
8548 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
8604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 358
Target Start/End: Original strand, 34932 - 34988
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctggt |
358 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
34932 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
34988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 3454 - 3407
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3454 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
3407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 82342 - 82389
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
82342 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
82389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 82705 - 82658
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
82705 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
82658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 75360 - 75407
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
75360 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggtttta |
75407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 75763 - 75716
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
75763 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
75716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 12183 - 12230
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
12183 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
12230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 12535 - 12488
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12535 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
12488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Complemental strand, 17965 - 17920
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
17965 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
17920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 343
Target Start/End: Complemental strand, 2882 - 2841
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
343 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2882 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
2841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 2659 - 2612
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
2659 |
gctaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
2612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 18042 - 17995
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
18042 |
gctaaaatatggttttagtccctgcgaatatgcctcgttttggattta |
17995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 16725 - 16772
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
16725 |
gctaaaatatgattttggtccctgcaaatatatctcgttttggtttta |
16772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 4078 - 4031
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
4078 |
gctaaaatacggttttggtccctgcaaatatgtctcgttttagtttta |
4031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 3753 - 3807
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcctg |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
3753 |
gctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg |
3807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 302 - 352
Target Start/End: Complemental strand, 7263 - 7213
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatt |
352 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
7263 |
gctaaaatatgattttggtctctgcaaatatgtcttgttttggttttaatt |
7213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Complemental strand, 5067 - 5022
Alignment:
| Q |
304 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggtttta |
5022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 303 - 355
Target Start/End: Original strand, 17126 - 17178
Alignment:
| Q |
303 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaattcct |
355 |
Q |
| |
|
||||||||||||||| |||||| ||||||||| | |||||||||||| ||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagttcct |
17178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 32; Significance: 0.000000009; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 22054 - 22007
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| |||||| ||||| || ||||||||||||||| |
|
|
| T |
22054 |
gctaaaatatggttttggtcccttcaaatttgcctcgttttggtttta |
22007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 348
Target Start/End: Original strand, 21763 - 21797
Alignment:
| Q |
314 |
ttttagtccctgcaaatatgtctcgttttggtttt |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggtttt |
21797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 21697 - 21745
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
21697 |
gctaaaatatggttttgatccctgcaaatatgt-tcgttttggtattaat |
21745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 302 - 349
Target Start/End: Complemental strand, 35083 - 35036
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
349 |
Q |
| |
|
|||||||||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
35083 |
gctaaaatatggttttgatccgtacaaatatgtctcgttttggtttta |
35036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 189677 - 189628
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
189677 |
gctaaaatatagtttttgtcgctgcaaatatgcctcattttggttttaat |
189628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 44205 - 44156
Alignment:
| Q |
302 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat |
351 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
44205 |
gctaaaatatggctttggtccctgcaaatatgcttcattttggttttaat |
44156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University