View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12559_high_18 (Length: 261)
Name: NF12559_high_18
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12559_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 76 - 228
Target Start/End: Original strand, 35978224 - 35978376
Alignment:
| Q |
76 |
ggttgagagtgatcgttttatgagcttcatatatgataatgataaacataggtgattgggaaatcagcagagatggatgattgttttataatagacaaat |
175 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35978224 |
ggttgagagtgatcattttatgagcttcatatatgataatgataaacataggtgattgggaaatcagcagagatggatgattgtttcataatagacaaat |
35978323 |
T |
|
| Q |
176 |
ggaaccttgttgtggaattaagcataattttctgtattttcaaatcacgtttg |
228 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35978324 |
ggaaccttgttgtggacttaagcataattttatgtattttcaaatcacgtttg |
35978376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 49
Target Start/End: Original strand, 35978166 - 35978197
Alignment:
| Q |
18 |
atataggtgattgcgagttagcactattagta |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35978166 |
atataggtgattgcgagttagcactattagta |
35978197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University