View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12559_high_18 (Length: 261)

Name: NF12559_high_18
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12559_high_18
NF12559_high_18
[»] chr3 (2 HSPs)
chr3 (76-228)||(35978224-35978376)
chr3 (18-49)||(35978166-35978197)


Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 76 - 228
Target Start/End: Original strand, 35978224 - 35978376
Alignment:
76 ggttgagagtgatcgttttatgagcttcatatatgataatgataaacataggtgattgggaaatcagcagagatggatgattgttttataatagacaaat 175  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
35978224 ggttgagagtgatcattttatgagcttcatatatgataatgataaacataggtgattgggaaatcagcagagatggatgattgtttcataatagacaaat 35978323  T
176 ggaaccttgttgtggaattaagcataattttctgtattttcaaatcacgtttg 228  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||||||    
35978324 ggaaccttgttgtggacttaagcataattttatgtattttcaaatcacgtttg 35978376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 49
Target Start/End: Original strand, 35978166 - 35978197
Alignment:
18 atataggtgattgcgagttagcactattagta 49  Q
    ||||||||||||||||||||||||||||||||    
35978166 atataggtgattgcgagttagcactattagta 35978197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University