View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12559_high_28 (Length: 219)
Name: NF12559_high_28
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12559_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 6993321 - 6993481
Alignment:
| Q |
18 |
agaagcattgaaagactccaatagtgtgaaatttgcaagagcatcaacttcaaaacttgggttaagacgacctttgtgggttctattcaacccagccact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993321 |
agaagcattgaaagactccaatagtgtgaaatttgcaagagcatcaacttcaaaactcgggttaagacgacctttgtgggttctattcaacccagccact |
6993420 |
T |
 |
| Q |
118 |
ttgataccaacaacttgatcgttccggcactcaacaccggtccagttccgacatggatcag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993421 |
ttgataccaacaacttgatcgttccggcactcaacaccggtccagttccgacatggatcag |
6993481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University