View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12559_low_15 (Length: 376)
Name: NF12559_low_15
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12559_low_15 |
 | |
|
| [»] scaffold0856 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0856 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 4094 - 3824
Alignment:
| Q |
1 |
tctcaggattttcagatgaagattgggcaaccaatatatacgacagaaaatcgtttgcaggttattgtatatttttggtacagagtttgataacttgtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4094 |
tctcaggattttcagatgaagattgggcaaccaatatatacgacagaaaatcgtttgcaggttattgtatatttttggtacagagtttgataacttgtcc |
3995 |
T |
|
| Q |
101 |
ctctagaaaataaaaagttgtgtcaagatctaggcagaatcagaatacaaggcattagcagaccttgcagcacatgtatcttgaatccggtctatattat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3994 |
ctctagaaaataaaaagttgtgtcaagatctaggcagaatcagaatacaagacattagcagaccttgcagcacatgtagcttgaatccgatctatattat |
3895 |
T |
|
| Q |
201 |
aggaaataaagttgaaatacctcaaacaagtgtattgtggtgtgaaaatttgagtgctaagcttttgcttc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894 |
aggaaataaagttgaaatacctcaaacaagtgtattgtggtgtgaaaatttgagtgctaagcttttgcttc |
3824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 305 - 366
Target Start/End: Complemental strand, 3817 - 3756
Alignment:
| Q |
305 |
agaagtggatgtgcactatatcagagatcagttgttgagtaataacgtgactatagcctatg |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3817 |
agaagtggatgtgcactatatcagagatcagttgttgagtaataacgcgactatagcctatg |
3756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University