View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12559_low_22 (Length: 329)

Name: NF12559_low_22
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12559_low_22
NF12559_low_22
[»] chr1 (1 HSPs)
chr1 (210-325)||(767764-767879)


Alignment Details
Target: chr1 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 210 - 325
Target Start/End: Complemental strand, 767879 - 767764
Alignment:
210 caagttgttgtcaatatataccttaactccaaatatattgagtaccaattttgcacaagcataagagcaaatagcttccaatgattgnnnnnnncgatca 309  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||    
767879 caagttgttgtcaatatataccttaactccaaataaattgagtaccaattttgcacaagcataagagcaaatagcttccaatgattgtttttttcgatca 767780  T
310 attgtggcctttgctt 325  Q
    ||||||||||| ||||    
767779 attgtggccttagctt 767764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University