View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12559_low_22 (Length: 329)
Name: NF12559_low_22
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12559_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 210 - 325
Target Start/End: Complemental strand, 767879 - 767764
Alignment:
| Q |
210 |
caagttgttgtcaatatataccttaactccaaatatattgagtaccaattttgcacaagcataagagcaaatagcttccaatgattgnnnnnnncgatca |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
767879 |
caagttgttgtcaatatataccttaactccaaataaattgagtaccaattttgcacaagcataagagcaaatagcttccaatgattgtttttttcgatca |
767780 |
T |
 |
| Q |
310 |
attgtggcctttgctt |
325 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
767779 |
attgtggccttagctt |
767764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University