View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12559_low_24 (Length: 314)
Name: NF12559_low_24
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12559_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 7 - 304
Target Start/End: Complemental strand, 49942373 - 49942076
Alignment:
| Q |
7 |
tgaggtgcttctctaacctaagttctttactttcatgatctatttgtaaccatggtaagattgtttttagcttcagtagtgggaaagtttatttgtggaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49942373 |
tgaggtgcttctctaacctaagttctttactttcatgatctatttgtaaccatggtaagattgtttttagcttcagtagtgggaaagtttatttgtggaa |
49942274 |
T |
 |
| Q |
107 |
ttctaaaatgattggtaaataacacctgccatagcttttggcttaggtcgtggaaccttgtagatctcatgttacatcaactttcttcaaacagtgttat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49942273 |
ttctaaaatgattggtaaataacacctgccatagcttttggcttaggtcgtggaaccttgtagatctcatgttacatcaactttcttcaaacagtgttat |
49942174 |
T |
 |
| Q |
207 |
aattatcatggcatgagcatgacactacttgcccattattcttgataattgatattgcttcatctgtttgatatattgttttcttgtgccacaggttc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49942173 |
aattatcatggcatgagcatgacactacttgccagttattcttgataactgatattgcttcatctgtttgatatattgttttcttgtgctacaggttc |
49942076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University