View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12559_low_33 (Length: 249)
Name: NF12559_low_33
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12559_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 43800156 - 43799916
Alignment:
| Q |
1 |
ataggcaaactgggcataaatatagggcaaatttgtctggttatctttatggttaaactaatgactttttgtgaacttcaaaaagattggaaagatctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43800156 |
ataggcaaactgggcataaatatagggcaaatttgtctggttatctttatggttaaactaatgattttttgtgaacttcaaaaagattggaaagatctaa |
43800057 |
T |
 |
| Q |
101 |
tgttttgtattttttacgatgccctatacctgtagaagtgtaactatttacaattctannnnnnnnnnnnnnnnnnnnnnnnctctttcgataaattcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43800056 |
tgttttgtattttttacgatgccctatacccgtagaagtgtaactatttacaattctattttttgtattttctaatttttttctctttcgataaattcat |
43799957 |
T |
 |
| Q |
201 |
tcctttgcctgacgaaatatacttatgtgatggtctctgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43799956 |
tcctttgcctgacgaaatatacttatgtgatggtttctgct |
43799916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University