View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12559_low_39 (Length: 239)
Name: NF12559_low_39
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12559_low_39 |
 | |
|
| [»] scaffold0856 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0856 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 4217 - 4439
Alignment:
| Q |
1 |
gtagatggaggcgggtttgtcaaaagtaatgcagaaatcttcaaacacnnnnnnnctgtaatcttctgatggcggcctggtagtgaatgaacttgttggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4217 |
gtagatggaggcgggtttgtcaaaagtaatgcagaaatcttcaaacagaaaaaaactgtaatcttctgatggtggcctggtagtgaatgaacttgttggt |
4316 |
T |
|
| Q |
101 |
tgaggtttggagacatgttgactcaattgtcggatggtgaaagagataactgaccaggtagtaggttaagtatacaattcatctacacttggattcatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4317 |
tgaggtttggagacatgttgactcaattgtcggatggtgaaagagataactgaccaggtagtaggttaagtatacaattcatctacacttggattcatga |
4416 |
T |
|
| Q |
201 |
tcatcaaatacaaatcatgtttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4417 |
tcatcaaatacaaatcatgtttc |
4439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University