View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12559_low_40 (Length: 234)
Name: NF12559_low_40
Description: NF12559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12559_low_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 234
Target Start/End: Complemental strand, 45556876 - 45556651
Alignment:
| Q |
13 |
gtaatatatattgatgcttattggtattgatcatattcatattagatagat----gatgagtcagatcctttttgaccgcaggaatgtgaagaactgatg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45556876 |
gtaatatatattgatgcttattggtattgatcatattcatattagatagatagatgatgagtcagatcctttttgaccgcaggaatgtgaagaactgatg |
45556777 |
T |
 |
| Q |
109 |
gtcaaagggttcagcggcgacacttacattccggaaggtagaagttcctgtagaccttatgagagacgaccaggtcaaactctacatgttcaatctgcag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
45556776 |
gtcaaagggttcagcggcgacacttacattccggagggtagaagttcctgtagaccttatgagagacgaccaagtcaaactctacatgttcaatctgcgg |
45556677 |
T |
 |
| Q |
209 |
tgaccaaggaagcgaaatggcagtgc |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45556676 |
tgaccaaggaagcgaaatggcagtgc |
45556651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University