View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255_high_14 (Length: 304)
Name: NF1255_high_14
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 5 - 235
Target Start/End: Original strand, 51730206 - 51730435
Alignment:
| Q |
5 |
ttagttgtcatgggaagcaatatacaacgacattctatattgtgcatattagttttgattttttaattacataaaaattcataatcaagtaacttgagag |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51730206 |
ttagttgtcatgagaagcaatatacaacgacattctatattgtgcat-ttagttttgattttttaattacataaaaattcataatcaagtaacttgagag |
51730304 |
T |
 |
| Q |
105 |
taggttttaattaattaccttggtttgcatgtgcacactccatgactaaatcgatagcagattttttgaaaccaacgaccacaacctttttgttgttggg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| | |
|
|
| T |
51730305 |
taggttttaattaattaccttggtttgcatgtgcacactccatgactaaatcgatagcagattttttgaaaccaaccacaacaacctttttgttgttgag |
51730404 |
T |
 |
| Q |
205 |
aagttggttagcagcatgttggtcaagttta |
235 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| |
|
|
| T |
51730405 |
aagttgattagcagcttgttggtcaagttta |
51730435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 119 - 192
Target Start/End: Original strand, 19190916 - 19190989
Alignment:
| Q |
119 |
ttaccttggtttgcatgtgcacactccatgactaaatcgatagcagattttttgaaaccaacgaccacaacctt |
192 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||| ||||| ||||||||| |||| || || |||||||| |
|
|
| T |
19190916 |
ttaccttggtttgcctgtgcacactccatggctagatcaatagctgattttttgtaacccacaacgacaacctt |
19190989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 119 - 195
Target Start/End: Original strand, 6897609 - 6897685
Alignment:
| Q |
119 |
ttaccttggtttgcatgtgcacactccatgactaaatcgatagcagattttttgaaaccaacgaccacaaccttttt |
195 |
Q |
| |
|
|||||||||||| | |||||||| |||||| | | ||| |||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
6897609 |
ttaccttggttttcctgtgcacattccatggcaatatcagtagctgattttttgaaaccaatcaccacaactttttt |
6897685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University