View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255_high_9 (Length: 357)
Name: NF1255_high_9
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 6e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 209 - 343
Target Start/End: Original strand, 40360641 - 40360775
Alignment:
| Q |
209 |
cactgtccctttaatgtttccctcctctgttttggtctctgcctcaactttctcatttgaatcaaccactttctcttctcttagatcaatgtctttgtta |
308 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40360641 |
cactgtcccttcaatatttccctcctctgttttggtctctgcctcaactttctcatttgaatcaaccactttctcttctcttagatcaatgtctttgtta |
40360740 |
T |
 |
| Q |
309 |
atgttaatcttctcctccttctcctccttctcctc |
343 |
Q |
| |
|
||||| |||||||||| ||||| ||||| |||||| |
|
|
| T |
40360741 |
atgttcatcttctccttcttcttctcctcctcctc |
40360775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University