View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255_low_1 (Length: 631)
Name: NF1255_low_1
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 438; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 438; E-Value: 0
Query Start/End: Original strand, 98 - 547
Target Start/End: Original strand, 7559160 - 7559609
Alignment:
| Q |
98 |
agcagcaccacagagatagcagcaatagcaggtgggttaatctcaactcctgttataggttggtctctctacacactcaaaacaactggttgtggtcttc |
197 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7559160 |
agcagcccaacagagatagcagcaatagcaggtgggttaatctcaactcctgttataggttggtctctctacacactcaaaacaactggttgtggtcttc |
7559259 |
T |
|
| Q |
198 |
caccaggaccaggtggatcaattggtgcattagaaggtgtaagttatcttgttgttgtgggcattgttgcttggtctatatatactaaaacaaaaactgg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7559260 |
caccaggaccaggtggatcaattggtgcattagaaggtgtaagttatcttgttgttgtgggcattgttgcttggtctatatatactaaaacaaaaactgg |
7559359 |
T |
|
| Q |
298 |
ttctggtcttcctaatggtccttttgggttattaggtgctgttgaagggttgtcatatttggcattggttgctattgttgttgtttttggtttgcagtat |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7559360 |
ttctggtcttcctaatggtccttttgggttattaggtgctgttgaagggttgtcatatttggcattggttgctattgttgttgtttttggtttgcagtat |
7559459 |
T |
|
| Q |
398 |
tttcaacaaggttacattccaggtcctctccctgctgatcagtgttttggctagattttctgtttttcctttgattttcattaggataatgtgatatgag |
497 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7559460 |
tttcaacaaggttatattccaggtcctctccctgctgatcagtgttttggctagattttctgtttttcctttgattttcattaggataatgtgatatgag |
7559559 |
T |
|
| Q |
498 |
ccactactgttctatcattgcacttgtggatgtggttgctccatgcatgt |
547 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7559560 |
ccactactgttctatcattgcacttgtggatgtggttgctccatgcatgt |
7559609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University