View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255_low_11 (Length: 381)
Name: NF1255_low_11
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 5e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 136 - 284
Target Start/End: Original strand, 9016241 - 9016389
Alignment:
| Q |
136 |
gttaaacaagacacgttagggttatgattaaaatgtaatcctatgacaaattacatactttggctttaatttaacttgacctaacctattcctacactta |
235 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9016241 |
gttaaacaagacacgttagggttatgactaaaatgtaatcctatgacaaattacatactttggctttaatttaacttgacctaacctattcctatactta |
9016340 |
T |
 |
| Q |
236 |
ttgttcaacaacttaccaataaaattgaagatcaatttcatgttccttt |
284 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
9016341 |
ttgttcaacaacttagcaataaaattgaagatcaatttcatgtttcttt |
9016389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University