View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255_low_17 (Length: 327)
Name: NF1255_low_17
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 117 - 258
Target Start/End: Complemental strand, 49084241 - 49084100
Alignment:
| Q |
117 |
ctttctaaaaagtgttcttgcaatcgctgttgtctgattacaaagcaagccaatatatctgctgtctctcaagaagcttgacaaattttaccaccagttg |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49084241 |
ctttctaaaaagtattcttgcaatcgctgttgtctgattacaaagcaagccaatatatctgctgtctctcaagaagcttgacaaattttaccaccagttg |
49084142 |
T |
 |
| Q |
217 |
gtgcttccgaagactataaaatataaatccatgttctctgtg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49084141 |
gtgcttccgaagactataaaatataaatccatgttctctgtg |
49084100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University