View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255_low_20 (Length: 310)
Name: NF1255_low_20
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 127 - 218
Target Start/End: Complemental strand, 25128500 - 25128409
Alignment:
| Q |
127 |
ttttattgaactatttattttgtgcgtagatgactgcatattcggggttatgcgagttgacattggtcaaataaacaacttctttggttatg |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25128500 |
ttttattgaactattttttttgtgcgtagatgactgcatattcggggttatgcgagttgacattggtcaaataaactacttctttggttatg |
25128409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 83 - 147
Target Start/End: Original strand, 28969623 - 28969687
Alignment:
| Q |
83 |
taattctaatagatatatcagataaaatcacatatatgtccaatttttattgaactatttatttt |
147 |
Q |
| |
|
||||||| |||||||||||||| |||| ||||||||| | |||||||||| |||| ||| |||| |
|
|
| T |
28969623 |
taattcttatagatatatcagaaaaaagtacatatatgcctaatttttattaaactgtttttttt |
28969687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University