View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255_low_23 (Length: 282)
Name: NF1255_low_23
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 41 - 219
Target Start/End: Original strand, 33433846 - 33434024
Alignment:
| Q |
41 |
gatatgaaaacaaacttcaacaatagacaagaacgaaagcaaggggatatattaccttaacttccaaaacaacggaattgtccatagctgattagatgaa |
140 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33433846 |
gatatgaaaacaaacttcaacgatagacaagaacgaaagcaaaggggtatattaccttaacttccaaaacaacggaattgtccatagctgattagatgaa |
33433945 |
T |
|
| Q |
141 |
tgggaacaaatgaatgaatcgcgcactcgattggaacgagaacgataacgaaaacgagaagcagtttatccctagggtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33433946 |
tgggaacaaatgaatgaatcgcgcactcgattggaacgagaacgataacgaaaacgagaagcagtttatccctagggtt |
33434024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University