View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1255_low_25 (Length: 263)
Name: NF1255_low_25
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1255_low_25 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 31 - 189
Target Start/End: Original strand, 49196 - 49354
Alignment:
| Q |
31 |
ataaagatgatgaagaagatgaagaagacgacgaagataacatggatgttgaactcgctaagtttcgtgctgttggtgatcctcacaaaatggccaagat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49196 |
ataaagatgatgaagaagatgaagaagaagacgaagataacatggatgttgaactcgctaagtttcgtgctgttggtgatcctcacaaaatggccaagat |
49295 |
T |
|
| Q |
131 |
gcagtttgttactaatttcattcttttcttcaattatatgttatttttcatatcatatg |
189 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
49296 |
gcagtttgttactaatttcattctttttctcaattttatgttatttttcatatcatatg |
49354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 136
Target Start/End: Original strand, 17814920 - 17815014
Alignment:
| Q |
39 |
gatgaagaagatgaagaagacgacgaagataacatggatgttgaactcgctaagtttcgtgctgttggtgatcctcacaaaatggccaagatgcagtt |
136 |
Q |
| |
|
|||||||||||||| ||||| || |||||| |||||||||||||| |||||||||| | ||| |||||| ||||| |||||||| ||||||||||| |
|
|
| T |
17814920 |
gatgaagaagatgatgaagaaga---agataatatggatgttgaacttgctaagtttcctactgctggtgaccctcataaaatggctaagatgcagtt |
17815014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University