View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12560_high_7 (Length: 308)
Name: NF12560_high_7
Description: NF12560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12560_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 16 - 290
Target Start/End: Complemental strand, 36496399 - 36496125
Alignment:
| Q |
16 |
cactgctgggttgtgggttcaagctatggttgctgcattttattgtttcttcaatggtggcttgtaatcatatcagtcaaacatattatagttggtaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36496399 |
cactgctgggttgtgggttcaagctatggttgctgcattttattgtttcttcaatggtggcttgtaatcatatcagtcaaacatattatagttggtaaca |
36496300 |
T |
 |
| Q |
116 |
accttcatactgtttatactttctctctcacatctttgttcaatacttgtttcttcattcccaacacccaaaatggaacaagaacatgatatcagactaa |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36496299 |
accttcataccgtttatactttctctctcacatctttgttcaatacttgtttcttcattcccaacacccaaaatggaacaagaacatgatatcagactaa |
36496200 |
T |
 |
| Q |
216 |
gtttgtctctagaagatttgggtttcaatgctgaaaatgacagcaataagagaaaatcgagcaaaaagtactata |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36496199 |
gtttgtctctagaagatttgggtttcaatgctgaaaatgacagcaataagagaaaatcgagcaaaaagtactata |
36496125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 154 - 263
Target Start/End: Complemental strand, 36467878 - 36467769
Alignment:
| Q |
154 |
ttcaatacttgtttcttcattcccaacacccaaaatggaacaagaacatgatatcagactaagtttgtctctagaagatttgggtttcaatgctgaaaat |
253 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| | || | | |||||| || ||||| | ||||| || |||||||||||||||||| |
|
|
| T |
36467878 |
ttcaatacttgtttcttcattcctaacacacaaaatggaacaagtaaataacaatagactatgtgtgtctatggaagagttaggtttcaatgctgaaaat |
36467779 |
T |
 |
| Q |
254 |
gacagcaata |
263 |
Q |
| |
|
| ||||||| |
|
|
| T |
36467778 |
ggtagcaata |
36467769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University