View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12560_low_23 (Length: 240)
Name: NF12560_low_23
Description: NF12560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12560_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 28263406 - 28263175
Alignment:
| Q |
1 |
ttttgaaattcaagatacaactaagttacgttaataggttgtgttgatacttttctttaataaattgacaatttatggtcaagtatttagtttttgtggc |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28263406 |
ttttgaaattcaagatacaaccaagttacgttaataggtcgtgttgatactttt-tttaataaattgacaatttatggtcaagtatttagtttttgtggc |
28263308 |
T |
|
| Q |
101 |
atccctatattctatgcgtgttttgagcttaatctattatgtagtatgtgttgaattgcttcttcaaaaaacgtacttaaggtgagattaaagtagggtt |
200 |
Q |
| |
|
|||| ||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||| | ||||||||| |||||||||||||||| |
|
|
| T |
28263307 |
atccttatattctaagcgtgttttgaacttaacctattatgtagtatgtgttgaattgcttctttaaaaagcatacttaaggcaagattaaagtagggtt |
28263208 |
T |
|
| Q |
201 |
ttggtggagcaagagaataatttttgtgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28263207 |
ttggtggagcaagagaataatttttgtgatgtc |
28263175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University