View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12561_high_10 (Length: 203)
Name: NF12561_high_10
Description: NF12561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12561_high_10 |
 |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0160 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 137 - 190
Target Start/End: Complemental strand, 20818 - 20765
Alignment:
| Q |
137 |
cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20818 |
cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatct |
20765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University