View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12561_high_6 (Length: 259)
Name: NF12561_high_6
Description: NF12561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12561_high_6 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 24 - 259
Target Start/End: Original strand, 924410 - 924634
Alignment:
| Q |
24 |
ggacaagtagagttaaaggaagttgcacggaagaaggtatcaagttgggatcaagcaagaaaaaggtagtaactagtaagggatttcaaggctgcttcat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
924410 |
ggacaagtagagttaaaggaagttgcacggaagaaggtatca-----------agcaagaaaaaggtagtaaatagtaagggatttcaaggctgctttat |
924498 |
T |
 |
| Q |
124 |
gtctctgcctgccatggttgacttgaatatgcattaaaatggatccaagcctatgaaattctttatatatgctagcaaaaattatatannnnnnnnaata |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
924499 |
gtctctgcctgccatggttgacttgaatatgcattaaaatggatccaagcctatgaaattctttatatatgctagcaaaaattatattatttttttaata |
924598 |
T |
 |
| Q |
224 |
cttgtagagaaaaataaattaatcatccattattga |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
924599 |
cttgtagagaaaaataaattaatcatccattattga |
924634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 38 - 180
Target Start/End: Original strand, 926414 - 926548
Alignment:
| Q |
38 |
aaaggaagttgcacggaagaaggtatcaagttgggatcaagcaagaaaaaggtagtaactagtaagggatttcaaggctgcttcatgtctctgcctgcca |
137 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||| || | ||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
926414 |
aaaggaagttgcacggaagaaaggtcgaagttgggatcaagcaagaaa------gtga--agtaatggatttcaaggctgcttcatgtctctgcctacct |
926505 |
T |
 |
| Q |
138 |
tggttgacttgaatatgcattaaaatggatccaagcctatgaa |
180 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
926506 |
tggttgacttgaatatgcattaaatgggatccaaacctatgaa |
926548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University