View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12561_low_11 (Length: 242)
Name: NF12561_low_11
Description: NF12561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12561_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 41769882 - 41770088
Alignment:
| Q |
19 |
atcaataaagtgtaaaataaggattggaaaactcagatagtaggggaaatatatgtatttttacttgtgttcaattttgcgctacaatgcgatggacacc |
118 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41769882 |
atcaataaagtgtaaaattaggattgggaaactcagatagtagttgaaatatatgtatttttacttgtgttcaattttgcgctacaatgcgatggacacc |
41769981 |
T |
|
| Q |
119 |
ttacattggccttgggtaggttggggtttccactccagcactatagtggattccatgggtgccattaactagtcttttatcttgtaggcggggcaccttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41769982 |
ttacattggccttgggtaggttggggtttccactccagcactatagtggattccatgggtgccattaactagtcttttatcttgtaggtggggcaccttg |
41770081 |
T |
|
| Q |
219 |
tttgatg |
225 |
Q |
| |
|
||||||| |
|
|
| T |
41770082 |
tttgatg |
41770088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University