View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12561_low_17 (Length: 203)

Name: NF12561_low_17
Description: NF12561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12561_low_17
NF12561_low_17
[»] scaffold0160 (1 HSPs)
scaffold0160 (137-190)||(20765-20818)


Alignment Details
Target: scaffold0160 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 137 - 190
Target Start/End: Complemental strand, 20818 - 20765
Alignment:
137 cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatct 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20818 cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatct 20765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University