View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12562_low_3 (Length: 354)
Name: NF12562_low_3
Description: NF12562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12562_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 345
Target Start/End: Original strand, 34877910 - 34878232
Alignment:
| Q |
16 |
tctctctctaggttaatcagataaagtgttttaatgtctcatcttagggttaataatcaaccaattcaacccatttgagttggattggtttgatgatatt |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||| ||||||| |
|
|
| T |
34877910 |
tctctctctaggttaatcggataaagtgttttaatgtctcatcttagggttaataatcaaccaacccaatccatttg----------gtttggtgatatt |
34877999 |
T |
 |
| Q |
116 |
agtttgagacttgagagtttcttcttctttgatgttttaagtttaattccgatgccatt-----taggtaggctaatttaatttctttaaaaaattaaag |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||| || |||| ||||||| ||||| ||| | |
|
|
| T |
34878000 |
agtttgagacttgagagtctcttcttctttgatgttttaagtttaattccgatatcattacatttaggtaggttagtttagtttcttttaaaaaataatg |
34878099 |
T |
 |
| Q |
211 |
aaccaatgtcgaactcaagtcgtgttttcagttgaactaannnnnnngttgagtagaggttaattgtgtcaaatttgactcaactacactcatttgcagc |
310 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34878100 |
aaccaatgtcgaactcaagtcgagttttcagttgaactaattttt--gttgagtagaggttaattgtgtcaaatttgactcaactacactcatttgcagc |
34878197 |
T |
 |
| Q |
311 |
tcaatattgttctaccgcggtatccatctctctgc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34878198 |
tcaatattgttctaccgcggtatccatctctctgc |
34878232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 204
Target Start/End: Original strand, 32880790 - 32880822
Alignment:
| Q |
172 |
atttaggtaggctaatttaatttctttaaaaaa |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
32880790 |
atttaggtaggctaatttaacttctttaaaaaa |
32880822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University