View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12563_high_13 (Length: 221)
Name: NF12563_high_13
Description: NF12563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12563_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 203
Target Start/End: Original strand, 42821840 - 42822031
Alignment:
| Q |
12 |
gagaagaagggactatggtcactgtccaattcatacacactacctggtggccacctatttatcatggcttcctgttgctttggttttactacattgtctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42821840 |
gagaagaagggactatggtcactgtccaattcatacacactacctggtggccacctatttatcatggcttcctgttgctttggttttactacattgtctt |
42821939 |
T |
 |
| Q |
112 |
gccttgtctttatgtacacacggggcaccttctccacttcaacattctcaatgaattgtgcactggttaatgctaataatggtcctggcctc |
203 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42821940 |
gtcttgtctttatgtacacacggggcaccttctccacttcaacattctctatgaattgtgccctggttaatgctaataatggtcctggcctc |
42822031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University