View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12563_low_14 (Length: 214)

Name: NF12563_low_14
Description: NF12563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12563_low_14
NF12563_low_14
[»] chr7 (1 HSPs)
chr7 (16-193)||(33791362-33791539)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 33791539 - 33791362
Alignment:
16 aacctgtgacaacccctttggaaatggaatctagagccaaattctggtcaattgttaacacacctctccccaacaaaatctgattataaaattgatgatc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33791539 aacctgtgacaacccctttggaaatggaatctagagccaaattctggtcaattgttaacacacctctccccaacaaaatctgattataaaattgatgatc 33791440  T
116 aaacacaaaagaagtgttttgatccaaaaacaccaatggatccttaccttcaacaccacaccattgaaccaacgtttt 193  Q
    ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
33791439 aaaaacaaaagaagtgttttgatccaaaaacactaatggatccttaccttcaacaccacaccattgaaccaacctttt 33791362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University