View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12563_low_9 (Length: 300)
Name: NF12563_low_9
Description: NF12563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12563_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 290
Target Start/End: Original strand, 52205357 - 52205630
Alignment:
| Q |
20 |
agaggtacatggagaaatttttgctaggcctcttttaccttggaggtatgttatgtttttatcaacatgccagtgtggtgcgtagttttgtactattatc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52205357 |
agaggtacatggagaaatttttgctaggcctcttttacctttgaggtatgttatgtttttatcaacatgccagtgtggtgcgtagttttgtactattatc |
52205456 |
T |
 |
| Q |
120 |
caaacaactctcttcctaatatttagttgcaagccttgaaggtgggttggattcgtttaaatacagacaaagctagtattaaaggcggaacttatggtga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52205457 |
caaacaactctcttcctaatatttagttgcaagccttcaaggtgggttggattcgtttaaatacagacaaagctagtattaaaggcggaacttatggtga |
52205556 |
T |
 |
| Q |
220 |
tgtgattcgtaagaaagatgacaactgcttgtgtaatttctcgtag---ttttttagtcggtctagtacctatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
52205557 |
tgtgattcgtaagaaagatgacaactgcttgtgtaatttctcgtagtttttttttagtcggtctagtacttatg |
52205630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University