View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12566_high_6 (Length: 222)
Name: NF12566_high_6
Description: NF12566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12566_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 108 - 204
Target Start/End: Complemental strand, 25390191 - 25390095
Alignment:
| Q |
108 |
gagctgtagaagcaagtgcacctttggcggagaatgatattgttcagtcaataaaagccgttaccgagttccctcgctcatcttttgagttctatgt |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25390191 |
gagctgtagaagcaagtgcgcctttggcggagaatgatattgttcagtcaataaaagccgttaccgagttccctcgctcgtcttttgagttctatgt |
25390095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 25390284 - 25390235
Alignment:
| Q |
15 |
caaaggggctttgaaggagtaccagttccctctttgacattaattcagct |
64 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25390284 |
caaaggggctttgaaggagtaccggttccctctttgacattaattcagct |
25390235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University