View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12566_low_8 (Length: 222)

Name: NF12566_low_8
Description: NF12566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12566_low_8
NF12566_low_8
[»] chr4 (2 HSPs)
chr4 (108-204)||(25390095-25390191)
chr4 (15-64)||(25390235-25390284)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 108 - 204
Target Start/End: Complemental strand, 25390191 - 25390095
Alignment:
108 gagctgtagaagcaagtgcacctttggcggagaatgatattgttcagtcaataaaagccgttaccgagttccctcgctcatcttttgagttctatgt 204  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
25390191 gagctgtagaagcaagtgcgcctttggcggagaatgatattgttcagtcaataaaagccgttaccgagttccctcgctcgtcttttgagttctatgt 25390095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 25390284 - 25390235
Alignment:
15 caaaggggctttgaaggagtaccagttccctctttgacattaattcagct 64  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||    
25390284 caaaggggctttgaaggagtaccggttccctctttgacattaattcagct 25390235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University