View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12567_low_5 (Length: 320)
Name: NF12567_low_5
Description: NF12567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12567_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 110 - 305
Target Start/End: Complemental strand, 28465877 - 28465682
Alignment:
| Q |
110 |
atgagataggtttgttttcatattaatattaatatactcctagtgtttagttttttcccctaaacttagcaatcatagaagttgtgnnnnnnntgcataa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28465877 |
atgagataggtttgttttcatattaatattaatatactcctagtgtttagttttttcccctaaacttagcaatcatagaagttgtgaaaaaaatgcataa |
28465778 |
T |
|
| Q |
210 |
agcatgggtaagaatgagatgcatgacattgacagaatgctatcaccatcgttgagcgttgagctttaaaagatactctcatgacactgcatatat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28465777 |
agcatgggtaagaatgagatgcatgacattgacagaatgctatcaccatcgttgagcgttgagctttaaaagatactctcatgacactgcatatat |
28465682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 28465986 - 28465952
Alignment:
| Q |
1 |
aatagtagtaattttttggacttatagtttgtctc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28465986 |
aatagtagtaattttttggacttatagtttgtctc |
28465952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University