View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12568_high_17 (Length: 244)
Name: NF12568_high_17
Description: NF12568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12568_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 37108393 - 37108168
Alignment:
| Q |
1 |
atgtcttgtctgtgtcacttggtggctctgcttctaaccttttcaatgatagtgttgctattggatctttccatgctgctaagaaaggtattgttgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108393 |
atgtcttgtctgtgtcacttggtggctctgcttctaaccttttcaatgatagtgttgctattggatctttccatgctgctaagaaaggtattgttgttgt |
37108294 |
T |
 |
| Q |
101 |
ttgctctgctggcaatagtggaccaaatgatgctactgcatcaaatctagctccttggtatatcacagttggtgccagcacaatggatagagagttccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108293 |
ttgctctgctggcaatagtggaccaaatgatgctactgcatcaaatctagctccttggtatatcacagttggtgccagcacaatggatagagagttccct |
37108194 |
T |
 |
| Q |
201 |
agttatgttgttcttggtaacaattt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37108193 |
agttatgttgttcttggtaacaattt |
37108168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 223
Target Start/End: Original strand, 42734943 - 42735003
Alignment:
| Q |
163 |
tcacagttggtgccagcacaatggatagagagttccctagttatgttgttcttggtaacaa |
223 |
Q |
| |
|
||||||||| ||| |||||||| |||||||| ||| | ||||||||||| ||||||||||| |
|
|
| T |
42734943 |
tcacagttgctgcaagcacaattgatagagacttcacaagttatgttgtacttggtaacaa |
42735003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 223
Target Start/End: Complemental strand, 42743567 - 42743507
Alignment:
| Q |
163 |
tcacagttggtgccagcacaatggatagagagttccctagttatgttgttcttggtaacaa |
223 |
Q |
| |
|
||||||||| ||| |||||||| |||||||| ||| | ||||||||| ||||||||||||| |
|
|
| T |
42743567 |
tcacagttgctgcaagcacaatagatagagatttcacaagttatgttattcttggtaacaa |
42743507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 223
Target Start/End: Complemental strand, 42752926 - 42752866
Alignment:
| Q |
163 |
tcacagttggtgccagcacaatggatagagagttccctagttatgttgttcttggtaacaa |
223 |
Q |
| |
|
||||||||| ||| |||||||| |||||||| ||| | ||||||||| ||||||||||||| |
|
|
| T |
42752926 |
tcacagttgctgcaagcacaatagatagagatttcacaagttatgttattcttggtaacaa |
42752866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 223
Target Start/End: Complemental strand, 42762548 - 42762488
Alignment:
| Q |
163 |
tcacagttggtgccagcacaatggatagagagttccctagttatgttgttcttggtaacaa |
223 |
Q |
| |
|
||||||||| ||| |||||||| |||||||| ||| | ||||||||| ||||||||||||| |
|
|
| T |
42762548 |
tcacagttgctgcaagcacaattgatagagatttcacaagttatgttattcttggtaacaa |
42762488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 223
Target Start/End: Complemental strand, 42769426 - 42769365
Alignment:
| Q |
162 |
atcacagttggtgccagcacaatggatagagagttccctagttatgttgttcttggtaacaa |
223 |
Q |
| |
|
|||||||||| ||| || |||| ||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
42769426 |
atcacagttgctgcaagtacaacggatagagaattcactagttatgttactcttggtaacaa |
42769365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University