View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12568_high_21 (Length: 201)
Name: NF12568_high_21
Description: NF12568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12568_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 17 - 94
Target Start/End: Complemental strand, 31323294 - 31323218
Alignment:
| Q |
17 |
atatgtctaattaaacaccacaccatctgggcaagatggcaggtaaacaaagtgatacgaattacgaacgatgtgatg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
31323294 |
atatgtctaattaaacaccacaccatctgggcaagatggtagg-aaacaaagtgatacaaattacgaacgatgtgatg |
31323218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 129 - 186
Target Start/End: Complemental strand, 31323185 - 31323128
Alignment:
| Q |
129 |
tagtacccccattggcaacgaaaaagatgatgttttggtgaaaattctgagttttcat |
186 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
31323185 |
tagtacccccattggcaacgaagaagatgatgttttggtgaaaattctgggttttcat |
31323128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University