View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12568_low_13 (Length: 306)
Name: NF12568_low_13
Description: NF12568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12568_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 63 - 288
Target Start/End: Original strand, 41379432 - 41379657
Alignment:
| Q |
63 |
tacgcataagtcaataatcgaaccccacatcatatgcttaagtaatgtgagtcacttccccctcagaccacaccattttggcagtaaaatcatgtctaat |
162 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
41379432 |
tacgcataagtcaatagtcgaaccccacatcatatgcttaagtaatgtgagtcacttccccctcagaccacatcattttggtagtaaaatcatgtctaat |
41379531 |
T |
 |
| Q |
163 |
gatatgccaaccattagcttagacacatcatatgcttttgttgttcaagaatccgatctcgaacacgccaaatccaacaagattaaacagaatttcgatc |
262 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41379532 |
gatatgctaaccattagcttagacacttcatatgtttttgttgttcaagaatctgatctcgaacacgccaaatccaacaagactaaacagaatttcgatc |
41379631 |
T |
 |
| Q |
263 |
ttaatttggattttggtctctctgat |
288 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
41379632 |
ttaatttggatttcggtctctctgat |
41379657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 41379373 - 41379410
Alignment:
| Q |
20 |
actctttcaaggatcttcagcgcatataacggttatgt |
57 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
41379373 |
actctttcgaggatcttcagcgcatataacgattatgt |
41379410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University