View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12568_low_19 (Length: 245)
Name: NF12568_low_19
Description: NF12568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12568_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 37108307 - 37108521
Alignment:
| Q |
18 |
ctttcttagcagcatggaaagaaccaatagaagtaccgtcattgaaaacattagaagtagaggcaccaagtgacacagacaagacatcaacgccatcatg |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | || |||||||||| ||||||| |||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37108307 |
ctttcttagcagcatggaaagatccaatagcaacactatcattgaaaaggttagaagcagagccaccaagtgacacagacaagacatcaacaccatcatg |
37108406 |
T |
 |
| Q |
118 |
gatagccacatcaaatgctgcaagtatgtctgcatcaaagcactcatcgccgttaattggaggaaaacaaactttgtatgatgcaactcttgcttttggt |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108407 |
gatagctgcatcaaatgctgcaagtatgtctgcatcaaagcactcgtcgccattaattggaggccaacaaactttgtatgatgcaactcttgcttttggt |
37108506 |
T |
 |
| Q |
218 |
gaaccaccctttgct |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37108507 |
gaaccaccctttgct |
37108521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University