View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12568_low_21 (Length: 230)
Name: NF12568_low_21
Description: NF12568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12568_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 4623222 - 4623421
Alignment:
| Q |
12 |
gcagagagaagaagaaactcgacgacgctgtgattcgagaacaagcaatagctgctgctttgttgtataaacagcatcaacagaatcaacaatttgatcg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4623222 |
gcagagagaagaagaaactcgacgacgctgtgattcgagaacaagcaatagcagctgctttgttgtataaacagcatcaacagaatcaacaatttgatcg |
4623321 |
T |
 |
| Q |
112 |
atcaagttcgttacgttatccaaatggtgcttcaaagaggagtaataatggtagtaatgttttgcctcgtagttctagttctagagctagatcacttact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4623322 |
atcaagttcgttacgttatccaaatggtgcttcaaagaggagtaataatggtagtaatgttttgcctcgtagttctagttctagagctagatcacttact |
4623421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University