View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12568_low_24 (Length: 206)

Name: NF12568_low_24
Description: NF12568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12568_low_24
NF12568_low_24
[»] chr2 (1 HSPs)
chr2 (15-193)||(41675559-41675737)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 41675737 - 41675559
Alignment:
15 cacagagagcaaaacagaactatatgtatatgcaacatatataatcaaacatagaatatgataaatattaatctgaagtttacttggatgtgtatataat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41675737 cacagagagcaaaacagaactatatgtatatgcaacatatataatcaaacatagaatatgataaatattaatctgaagtttacttggatgtgtatataat 41675638  T
115 ttttcaccaatgtataaatctaataactcactttagttaactcttaattacaatcaaatctatgatattaaagtgatga 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
41675637 ttttcaccaatgtataaatctaataactcactttagttaactcttaattacaatcaaatctatgatattaaagttatga 41675559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University