View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12568_low_25 (Length: 201)

Name: NF12568_low_25
Description: NF12568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12568_low_25
NF12568_low_25
[»] chr7 (2 HSPs)
chr7 (17-94)||(31323218-31323294)
chr7 (129-186)||(31323128-31323185)


Alignment Details
Target: chr7 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 17 - 94
Target Start/End: Complemental strand, 31323294 - 31323218
Alignment:
17 atatgtctaattaaacaccacaccatctgggcaagatggcaggtaaacaaagtgatacgaattacgaacgatgtgatg 94  Q
    ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||    
31323294 atatgtctaattaaacaccacaccatctgggcaagatggtagg-aaacaaagtgatacaaattacgaacgatgtgatg 31323218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 129 - 186
Target Start/End: Complemental strand, 31323185 - 31323128
Alignment:
129 tagtacccccattggcaacgaaaaagatgatgttttggtgaaaattctgagttttcat 186  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||    
31323185 tagtacccccattggcaacgaagaagatgatgttttggtgaaaattctgggttttcat 31323128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University