View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12569_high_5 (Length: 289)
Name: NF12569_high_5
Description: NF12569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12569_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 82 - 273
Target Start/End: Complemental strand, 38580744 - 38580553
Alignment:
| Q |
82 |
tccaatcatgagaggtttgtgcaggatcagtgaaaggagattcaatgtgagaaattaaggggtgtgtgaaaagtgaatgagctaagattgcaaatgaaag |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38580744 |
tccaatcatgagaggtttgtgcaggatcagtgaaaggagattcaatgtgagaaattaaggggtgtgtgaaaagtgaatgtgctaagattgcaaatgaaag |
38580645 |
T |
 |
| Q |
182 |
agggaaaattaggattagggtaattaagtagaaggttttaggggaaatttttggaattgaaattgattcttttaagatgtttgggatgttga |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38580644 |
agggaaaattaggattagggtaattaagtagaaggttttaggggaaatttttggaattgaaattgattcttttaagatgtttgggatgttga |
38580553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 82 - 273
Target Start/End: Complemental strand, 6883564 - 6883373
Alignment:
| Q |
82 |
tccaatcatgagaggtttgtgcaggatcagtgaaaggagattcaatgtgagaaattaaggggtgtgtgaaaagtgaatgagctaagattgcaaatgaaag |
181 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
6883564 |
tccaatcatgagaggtttgtgaaggatcagtgaaaggagattgaagctgagaaattaaggggtgtgtgaaaagggaatgagctaaaattgcaaaagaaag |
6883465 |
T |
 |
| Q |
182 |
agggaaaattaggattagggtaattaagtagaaggttttaggggaaatttttggaattgaaattgattcttttaagatgtttgggatgttga |
273 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6883464 |
agggaaaattagggttagggtaattaagtagaaggttttaggggaaattttagggattgaaattgattcttttaagatgtttgggatgttga |
6883373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University