View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12569_low_8 (Length: 269)
Name: NF12569_low_8
Description: NF12569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12569_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 33592113 - 33591872
Alignment:
| Q |
18 |
ctttccttcccaagcaggctgatgtctttccagataaggaaaatttcggtagaatattctataatcaggctataatgtctgctcaagggattccccaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33592113 |
ctttccttcccaagcaggctgatgtctttccagataaggaaaatttcggtagaatattctataatcaggctataatgtctgctcaagggattccccaaat |
33592014 |
T |
|
| Q |
118 |
tgcattggtgttaggctcttgcactgctggtggtgcctatatacctgctatggctgatgaaagtgtgatggtcaagggaaatggcactannnnnnnagca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33592013 |
tgcattggtgttaggctcttgcactgctggtggtgcctatatacctgctatggctgatgaaagtgtgatggtcaagggaaatggcactatttttttagca |
33591914 |
T |
|
| Q |
218 |
gggccccctcttgttaaggtcagctccaatatcctttctgtg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33591913 |
gggccccctcttgttaaggtcagctccaatatcctttctgtg |
33591872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 138 - 237
Target Start/End: Complemental strand, 3068582 - 3068483
Alignment:
| Q |
138 |
gcactgctggtggtgcctatatacctgctatggctgatgaaagtgtgatggtcaagggaaatggcactannnnnnnagcagggccccctcttgttaaggt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
3068582 |
gcactgctggtggtgcctatatacctgctatggctgatgaaagtgtcatggtcaaggaaaatggcattattgttttagcagggccccctcttgttaaggt |
3068483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University